[med-svn] [Git][med-team/htsjdk][master] 3 commits: Raising Standards version to 4.7.0 (no change)
Pierre Gruet pushed to branch master at Debian Med / htsjdk Commits: c24b7734 by Pierre Gruet at 2024-05-15T21:56:44+02:00 Raising Standards version to 4.7.0 (no change) - - - - - ac9f152a by Pierre Gruet at 2024-05-15T22:00:59+02:00 Updating autopkgtest linked to drop-seq after changes in this package - - - - - 5532e2d6 by Pierre Gruet at 2024-05-15T22:01:10+02:00 Upload to unstable - - - - - 3 changed files: - debian/changelog - debian/control - debian/tests/drop-seq-run-unit-test Changes: = debian/changelog = @@ -1,3 +1,10 @@ +htsjdk (4.1.0+dfsg-2) unstable; urgency=medium + + * Raising Standards version to 4.7.0 (no change) + * Updating autopkgtest linked to drop-seq after changes in this package + + -- Pierre Gruet Wed, 15 May 2024 22:01:02 +0200 + htsjdk (4.1.0+dfsg-1) unstable; urgency=medium * New upstream version 4.1.0+dfsg = debian/control = @@ -28,7 +28,7 @@ Build-Depends: default-jdk, libcommons-lang3-java, libjimfs-java, scala-library -Standards-Version: 4.6.2 +Standards-Version: 4.7.0 Vcs-Browser: https://salsa.debian.org/med-team/htsjdk Vcs-Git: https://salsa.debian.org/med-team/htsjdk.git Homepage: https://samtools.github.io/htsjdk/ = debian/tests/drop-seq-run-unit-test = @@ -21,25 +21,8 @@ gunzip -r ref/* gunzip -r org/broadinstitute/dropseq/annotation/* gunzip -r org/broadinstitute/dropseq/readtrimming/* mkdir out -#do_stuff_to_test_package# echo -e "\e[93m\e[1mTest 1\e[0m" -drop-seq TagBamWithReadSequenceExtended INPUT=org/broadinstitute/dropseq/annotation/test.bam \ -OUTPUT=out/TagBamWithReadSequenceExtended-cellular.bam SUMMARY=TagBamWithReadSequenceExtended-cellular.bam_summary.txt BASE_RANGE=1-12 BASE_QUALITY=10 BARCODED_READ=1 DISCARD_READ=false TAG_NAME=XC NUM_BASES_BELOW_QUALITY=1 -samtools view out/TagBamWithReadSequenceExtended-cellular.bam > out/TagBamWithReadSequenceExtended-cellular.sam -diff out/TagBamWithReadSequenceExtended-cellular.sam ref/TagBamWithReadSequenceExtended-cellular.sam -echo -e "\e[92m\e[1mPassed\e[0m" -echo - -echo -e "\e[93m\e[1mTest 2\e[0m" -drop-seq TagBamWithReadSequenceExtended INPUT=org/broadinstitute/dropseq/annotation/test.bam \ -OUTPUT=out/TagBamWithReadSequenceExtended-molecular.bam SUMMARY=TagBamWithReadSequenceExtended-molecular.bam_summary.txt BASE_RANGE=1-12 BASE_QUALITY=10 BARCODED_READ=1 DISCARD_READ=false TAG_NAME=XM NUM_BASES_BELOW_QUALITY=1 -samtools view out/TagBamWithReadSequenceExtended-molecular.bam > out/TagBamWithReadSequenceExtended-molecular.sam -diff out/TagBamWithReadSequenceExtended-molecular.sam ref/TagBamWithReadSequenceExtended-molecular.sam -echo -e "\e[92m\e[1mPassed\e[0m" -echo - -echo -e "\e[93m\e[1mTest 3\e[0m" drop-seq FilterBam TAG_REJECT=XQ INPUT=org/broadinstitute/dropseq/readtrimming/N701.subset.tagged_filtered.sam \ OUTPUT=out/FilterBam.bam samtools view out/FilterBam.bam > out/FilterBam.sam @@ -47,7 +30,7 @@ diff out/FilterBam.sam ref/FilterBam.sam echo -e "\e[92m\e[1mPassed\e[0m" echo -echo -e "\e[93m\e[1mTest 4\e[0m" +echo -e "\e[93m\e[1mTest 2\e[0m" drop-seq TrimStartingSequence INPUT=out/FilterBam.bam OUTPUT=out/TrimStartingSequence.bam \ OUTPUT_SUMMARY=out/TrimStartingSequence.summary.txt SEQUENCE=AAGCAGTGGTATCAACGCAGAGTGAATGGG MISMATCHES=0 NUM_BASES=5 samtools view out/TrimStartingSequence.bam > out/TrimStartingSequence.sam @@ -55,7 +38,7 @@ diff out/TrimStartingSequence.sam ref/TrimStartingSequence.sam echo -e "\e[92m\e[1mPassed\e[0m" echo -echo -e "\e[93m\e[1mTest 5\e[0m" +echo -e "\e[93m\e[1mTest 3\e[0m" drop-seq PolyATrimmer INPUT=out/TrimStartingSequence.bam OUTPUT=out/PolyATrimmer.bam \ OUTPUT_SUMMARY=out/PolyATrimmer.summary.bam MISMATCHES=0 NUM_BASES=6 USE_NEW_TRIMMER=true samtools view out/PolyATrimmer.bam > out/PolyATrimmer.sam View it on GitLab: https://salsa.debian.org/med-team/htsjdk/-/compare/80d13b32682bcff805d8acbf5b86add4677c9491...5532e2d62b6fed55df6d713bf1d753624bc8344c -- View it on GitLab: https://salsa.debian.org/med-team/htsjdk/-/compare/80d13b32682bcff805d8acbf5b86add4677c9491...5532e2d62b6fed55df6d713bf1d753624bc8344c You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/htsjdk] Pushed new tag debian/4.1.0+dfsg-2
Pierre Gruet pushed new tag debian/4.1.0+dfsg-2 at Debian Med / htsjdk -- View it on GitLab: https://salsa.debian.org/med-team/htsjdk/-/tree/debian/4.1.0+dfsg-2 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/community/helper-scripts][master] automatic update
Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: fddbd000 by Andreas Tille at 2024-05-16T01:42:51+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: = debian-med-tests.txt = @@ -1,4 +1,4 @@ -Last-Update: Wed, 15 May 2024 13:42:04 + +Last-Update: Thu, 16 May 2024 01:42:04 + Source| Vote | Tasks | Tags ---+++-- = debian-science-tests.txt = @@ -1,4 +1,4 @@ -Last-Update: Wed, 15 May 2024 13:42:08 + +Last-Update: Thu, 16 May 2024 01:42:04 + Source | Vote | Tasks | Tags ---++-+- = outdated_med-packages.txt = The diff for this file was not included because it is too large. = python-team-tests.txt = @@ -1,4 +1,4 @@ -Last-Update: Wed, 15 May 2024 13:42:11 + +Last-Update: Thu, 16 May 2024 01:42:04 + Source | Vote | Tags ++ View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/fddbd000b6cdf99df70f7435047a3a94bc9fb3aa -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/fddbd000b6cdf99df70f7435047a3a94bc9fb3aa You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/igraph] Pushed new tag debian/0.10.12+ds-1_bpo12+1
Jérôme Benoit pushed new tag debian/0.10.12+ds-1_bpo12+1 at Debian Med / igraph -- View it on GitLab: https://salsa.debian.org/med-team/igraph/-/tree/debian/0.10.12+ds-1_bpo12+1 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/igraph][bookworm-backports] 12 commits: Rename libraries for 64-bit time_t transition.
Jérôme Benoit pushed to branch bookworm-backports at Debian Med / igraph Commits: d2e295f8 by Lukas Märdian at 2024-02-28T12:16:26+01:00 Rename libraries for 64-bit time_t transition. Closes: #1062443 Signed-off-by: Étienne Mollier emoll...@debian.org - - - - - df5a8dce by Jerome Benoit at 2024-04-03T11:44:42+02:00 New upstream version 0.10.11 - - - - - 00b0f70a by Jerome Benoit at 2024-04-03T11:44:56+02:00 Update upstream source from tag upstream/0.10.11 Update to upstream version 0.10.11 with Debian dir e5c00723c7197431b0514cadb3b0ca3374712737 - - - - - cc27ca60 by Jerome Benoit at 2024-04-03T11:45:07+02:00 New upstream version 0.10.11+ds - - - - - 89bfe872 by Jerome Benoit at 2024-04-03T11:45:12+02:00 Update upstream source from tag upstream/0.10.11+ds Update to upstream version 0.10.11+ds with Debian dir e5c00723c7197431b0514cadb3b0ca3374712737 - - - - - 33044ee9 by Jerome Benoit at 2024-04-03T12:29:28+02:00 Debian patch 0.10.11+ds-1 - - - - - 60ed8466 by Jerome Benoit at 2024-05-09T19:54:43+02:00 New upstream version 0.10.12 - - - - - 886d2d3e by Jerome Benoit at 2024-05-09T19:54:54+02:00 Update upstream source from tag upstream/0.10.12 Update to upstream version 0.10.12 with Debian dir 2c1830b15613daf986b3cb8c017fa303447d0451 - - - - - aa87c794 by Jerome Benoit at 2024-05-09T19:55:04+02:00 New upstream version 0.10.12+ds - - - - - aee026fb by Jerome Benoit at 2024-05-09T19:55:08+02:00 Update upstream source from tag upstream/0.10.12+ds Update to upstream version 0.10.12+ds with Debian dir 2c1830b15613daf986b3cb8c017fa303447d0451 - - - - - d6f7f9e5 by Jerome Benoit at 2024-05-09T20:28:17+02:00 Debian patch 0.10.12+ds-1 - - - - - 9009f013 by Jerome Benoit at 2024-05-15T12:29:14+02:00 Debian patch 0.10.12+ds-1~bpo12+1 - - - - - 30 changed files: - ACKNOWLEDGEMENTS.md - CHANGELOG.md - CMakeLists.txt - CONTRIBUTING.md - CONTRIBUTORS.md - CONTRIBUTORS.txt - IGRAPH_VERSION - debian/changelog - debian/control - debian/libigraph-doc.docs - debian/libigraph3.install → debian/libigraph3t64.install - + debian/libigraph3t64.lintian-overrides - debian/libigraph3.symbols → debian/libigraph3t64.symbols - debian/patches/debianization.patch - debian/patches/upstream-fix-multiarch-file_conflict.patch - doc/CMakeLists.txt - + doc/bitset.xxml - doc/c-docbook.re - doc/cliques.xxml - doc/igraph-docs.xml - doc/installation.xml - doc/operators.xxml - doc/structural.xxml - + etc/cmake/bit_operations_support.cmake - examples/simple/igraph_is_separator.c - + examples/simple/igraph_join.c - + examples/simple/igraph_join.out - include/igraph.h - + include/igraph_bitset.h - + include/igraph_bitset_list.h The diff was not included because it is too large. View it on GitLab: https://salsa.debian.org/med-team/igraph/-/compare/c7d159785dcefc85b76230fcefcafb3312fdd37e...9009f01308b62d70fd9ad5134278ca8dd4a4b1d4 -- View it on GitLab: https://salsa.debian.org/med-team/igraph/-/compare/c7d159785dcefc85b76230fcefcafb3312fdd37e...9009f01308b62d70fd9ad5134278ca8dd4a4b1d4 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/libamplsolver][master] 3 commits: Fix FTBFS: fedisableexcept() is a GNU extension, so it has to be enabled by...
Andreas Tille pushed to branch master at Debian Med / libamplsolver Commits: cf42af0b by Andreas Tille at 2024-05-15T08:19:27+02:00 Fix FTBFS: fedisableexcept() is a GNU extension, so it has to be enabled by building with -D_GNU_SOURCE. - - - - - 8448460c by Andreas Tille at 2024-05-15T08:19:46+02:00 routine-update: Standards-Version: 4.7.0 - - - - - 2364ec62 by Andreas Tille at 2024-05-15T08:22:16+02:00 routine-update: Ready to upload to unstable - - - - - 4 changed files: - debian/changelog - debian/control - + debian/patches/fedisableexcept.patch - debian/patches/series Changes: = debian/changelog = @@ -1,3 +1,17 @@ +libamplsolver (0~20190702-3) unstable; urgency=medium + + * Team upload. + + [ Aurelien Jarno ] + * Fix FTBFS: fedisableexcept() is a GNU extension, so it has +to be enabled by building with -D_GNU_SOURCE. +Closes: #1070980 + + [ Andreas Tille ] + * Standards-Version: 4.7.0 (routine-update) + + -- Andreas Tille Wed, 15 May 2024 08:20:11 +0200 + libamplsolver (0~20190702-2) unstable; urgency=medium * Team upload. = debian/control = @@ -5,7 +5,7 @@ Section: science Priority: optional Build-Depends: debhelper-compat (= 13), d-shlibs -Standards-Version: 4.5.0 +Standards-Version: 4.7.0 Vcs-Browser: https://salsa.debian.org/med-team/libamplsolver Vcs-Git: https://salsa.debian.org/med-team/libamplsolver.git Homepage: https://ampl.com/netlib/ampl/ = debian/patches/fedisableexcept.patch = @@ -0,0 +1,26 @@ +Last-Update: Sun, 12 May 2024 13:02:02 +0200 +From: Aurelien Jarno +Bug-Debian: https://bugs.debian.org/1070980 +Description: fedisableexcept() is a GNU extension, so it has + to be enabled by building with -D_GNU_SOURCE. + +--- a/fpinit.c b/fpinit.c +@@ -49,6 +49,7 @@ int isatty_ASL; /* for use with "sw" und + #undef WIN32 + #define WIN32 + #else ++#define _GNU_SOURCE /* needed for fedisableexcept */ + #include "fenv.h" + #endif + +--- a/solvers/fpinit.c b/solvers/fpinit.c +@@ -49,6 +49,7 @@ int isatty_ASL; /* for use with "sw" und + #undef WIN32 + #define WIN32 + #else ++#define _GNU_SOURCE /* needed for fedisableexcept */ + #include "fenv.h" + #endif + = debian/patches/series = @@ -1 +1,2 @@ fix-makefile-shared-lib.patch +fedisableexcept.patch View it on GitLab: https://salsa.debian.org/med-team/libamplsolver/-/compare/08643b7f266ffc9652783c81a2a61089aa6bf347...2364ec6242e23a017fdc85aab868aa55f51df46a -- View it on GitLab: https://salsa.debian.org/med-team/libamplsolver/-/compare/08643b7f266ffc9652783c81a2a61089aa6bf347...2364ec6242e23a017fdc85aab868aa55f51df46a You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/libamplsolver] Pushed new tag debian/0_20190702-3
Andreas Tille pushed new tag debian/0_20190702-3 at Debian Med / libamplsolver -- View it on GitLab: https://salsa.debian.org/med-team/libamplsolver/-/tree/debian/0_20190702-3 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
