Re: RFS: cglm/0.9.4-1 -- Optimized OpenGL Mathematics library for C
Hi Leon, Le 18/05/2024 à 13:19, Leon Marz a écrit : Package: sponsorship-requests Severity: normal Dear mentors, I am looking for a sponsor for my package "cglm": * Package name : cglm Version : 0.9.4-1 Upstream contact : Recep Aslantas * URL : https://github.com/recp/cglm * License : Expat * Vcs : https://salsa.debian.org/debian/cglm Section : libs The source builds the following binary packages: libcglm-doc - Documentation for the cglm library libcglm-dev - Development files for the cglm library libcglm0 - Optimized OpenGL Mathematics library for C To access further information about this package, please visit the following URL: https://mentors.debian.net/package/cglm/ Alternatively, you can download the package with 'dget' using this command: dget -x https://mentors.debian.net/debian/pool/main/c/cglm/cglm_0.9.4-1.dsc Changes since the last upload: cglm (0.9.4-1) unstable; urgency=medium . * New upstream release * Update symbols file Could you please look at https://bugs.debian.org/1063028 as I think something has to be done there? There has been an API breakage in cglm, which thus should have been transitioned. Also you should raise the Standards version to the latest one. - Leon Thanks for your work on cglm, -- Pierre OpenPGP_signature.asc Description: OpenPGP digital signature
Re: maven-debian-helper: dependency org.kohsuke github-api not found
Hi Tobias, Le 18/05/2024 à 15:28, Tobias Hilbricht a écrit : Meanwhile I resolved some dependencies of the Zettelkasten app using https://wiki.debian.org/Java/MavenPkgs/Stable but some remain - they are in Maven and I have them here locally, but not in maven-debian: org.jdesktop:swing-worker:jar:1.1 org.jdesktop:appframework:jar:1.0.3 bibtex:javabib:jar:20040801 Admittedly these three ones are really needed by the software you are looking at. Would you consider packaging them? com.formdev:flatlaf:jar:3.2.5 It is feasible to patch the code to avoid needing this one, as is done by one of the patches of the jalview source package for instance. Other Look-and-Feel systems are handled by the code of Zettelkasten. I read https://wiki.debian.org/Java/MavenRepoHelper and found mh_installjar and thought I do it like this: root@syke:/home/tobias/zettelkasten# mh_installjar -l -- package=zettelkasten pom.xml /home/tobias/zettelkasten/target/Zettelkasten.app/Contents/Java/classpa th/org/jdesktop/swing-worker/1.1/swing-worker-1.1.jar but it did not work, because I could not install without debian/control, and to get a debian/control I had to ignore the dependencies, and they were no longer in pom.xml. You really don't have to worry about mh_installjar, instead in debian/control you should build-depend on maven-debian-helper which will do the right things to install the jars provided you fill in the files described at https://wiki.debian.org/Java/MavenDebianHelper among others the debian/$PACKAGE.poms file. Help is appreciated, thanks in advance A quick copyright review lead to no show-stopper, so you can go ahead with packaging. I think the first thing to do is to package the dependencies org.jdesktop:swing-worker org.jdesktop:appframework bibtex:javabib as they obviously will be needed. Tobias Best, -- Pierre OpenPGP_signature.asc Description: OpenPGP digital signature
Re: Any input for some talk about usage of Debian in HPC
Hi Andreas, Le 19/05/2024 à 13:12, Andreas Tille a écrit : Hi, I have an invitation to have some talk with the title Debian GNU/Linux for Scientific Research Abstract: Over the past decade, Enterprise Linux has dominated large-scale research computing infrastructure. However, recent developments have sparked increased interest in community-led alternatives. Debian GNU/Linux, a long-standing choice among researchers for supporting scientific work, is experiencing a renewed interest for High-Throughput Computing (HTC) and High-Performance Computing (HPC) applications. This presentation will provide an overview of how Debian is being utilized to support scientific research and will include a case study showcasing the migration of HTC operations from Enterprise Linux 7 (EL7) to Debian. While I could talk about Debian Science and Debian Med in general it would be cool to reference to some real life examples where Debian is used in Science and what might be the reason to use Debian. EDF (French electricity producer and provider, also present in many countries) has several calculation codes that run on supercomputers. These software are developed by the people from the Research and Development to do some simulation, modelling, ... in many fields: uncertainty treatment, simulation of complex systems, incompressible or expandable flow, stochastic control, hydraulics... [0] Most supercomputers in use at EDF are currently running Debian. Also the workstations of people in the R department are equipped with a (very close) derivative of Debian. Many of these calculation codes are free and can be found in Debian: openturns, stopt, code-saturne, syrthes, salome (formerly), astk (formerly). The first four ones are currently maintained in Debian-science or Debian-math. At some point, EDF chose to homogenise its scientific computing by basing workstations and supercomputers on Debian [1]: there is a consistent Debian-based environment for scientific informatics. Still, [1] is 13 years old, the strategy could evolve in the future. I personally would like to stress the "we package what we use" aspect and the "we mentor upstream to merge competence of the program with packaging skills" idea. Any input would be welcome to cover more ideas. Kind regards Andreas. Best, -- Pierre [0] https://www.edf.fr/en/the-edf-group/inventing-the-future-of-energy/rd-global-expertise/our-offers/our-software-and-calculation-codes [1] https://www.debian.org/News/2011/20110729 OpenPGP_signature.asc Description: OpenPGP digital signature
Re: [FFmpeg-devel] [PATCH] avcodec/jpeg2000dec: fix HT block decoder
On Sun, May 19, 2024 at 9:02 AM Andreas Rheinhardt
wrote:
>
> p...@sandflow.com:
> > From: Pierre-Anthony Lemieux
> >
> > Addresses https://trac.ffmpeg.org/ticket/10905
> >
> > Co-authored-by: Osamu Watanabe
> > Signed-off-by: Pierre-Anthony Lemieux
> > --> @@ -1297,14 +1299,14 @@ ff_jpeg2000_decode_htj2k(const
> Jpeg2000DecoderContext *s, Jpeg2000CodingStyle *c
> > for (int y = 0; y < height; y++) {
> > for (int x = 0; x < width; x++) {
> > n = x + (y * t1->stride);
> > -val = sample_buf[x + (y * width)];
> > +val = sample_buf[x + (y * quad_buf_width)];
> > /* Convert sign-magnitude to two's complement. */
> > val = val >> 31 ? 0x8000 - val : val;
> > val >>= (pLSB - 1);
> > t1->data[n] = val;
> > }
> > }
> > -free:
> > +free:
>
> Spurious change. It also seems unintentional and undesirable.
Yes. Will fix before merging.
>
> > av_freep(_buf);
> > av_freep(_states);
> > return ret;
>
> ___
> ffmpeg-devel mailing list
> ffmpeg-devel@ffmpeg.org
> https://ffmpeg.org/mailman/listinfo/ffmpeg-devel
>
> To unsubscribe, visit link above, or email
> ffmpeg-devel-requ...@ffmpeg.org with subject "unsubscribe".
___
ffmpeg-devel mailing list
ffmpeg-devel@ffmpeg.org
https://ffmpeg.org/mailman/listinfo/ffmpeg-devel
To unsubscribe, visit link above, or email
ffmpeg-devel-requ...@ffmpeg.org with subject "unsubscribe".
[jira] [Updated] (OFBIZ-13048) createPlugin - improve templates
[ https://issues.apache.org/jira/browse/OFBIZ-13048?page=com.atlassian.jira.plugin.system.issuetabpanels:all-tabpanel ] Pierre Smits updated OFBIZ-13048: - Description: With the parameterization of the menu location, improvements to the createPlugin templates are warranted. Replacing minilang folder with script folder, to ensure developers have a place to have their non-compiled script files (groovy and others). Removing non English labels, as in coding English is the internationally used language (and more particarly within the ASF communities). was: With the parameterization of the menu location, improvements to the createPlugin templates are warranted. replacing mining with script folder, to ensure developers have a place to have their non-compiled script files (groovy and others). Removing non English labels, as in coding English is the internationally used language (and more particarly within the ASF communities). > createPlugin - improve templates > > > Key: OFBIZ-13048 > URL: https://issues.apache.org/jira/browse/OFBIZ-13048 > Project: OFBiz > Issue Type: Improvement > Components: framework > Reporter: Pierre Smits >Priority: Major > Labels: development > > With the parameterization of the menu location, improvements to the > createPlugin templates are warranted. > Replacing minilang folder with script folder, to ensure developers have a > place to have their non-compiled script files (groovy and others). > Removing non English labels, as in coding English is the internationally used > language (and more particarly within the ASF communities). -- This message was sent by Atlassian Jira (v8.20.10#820010)
[jira] [Updated] (OFBIZ-13048) createPlugin - improve templates
[ https://issues.apache.org/jira/browse/OFBIZ-13048?page=com.atlassian.jira.plugin.system.issuetabpanels:all-tabpanel ] Pierre Smits updated OFBIZ-13048: - Description: With the parameterization of the menu location, improvements to the createPlugin templates are warranted. replacing mining with script folder, to ensure developers have a place to have their non-compiled script files (groovy and others). Removing non English labels, as in coding English is the internationally used language (and more particarly within the ASF communities). was:With the parameterization of the menu location, improvements to the createPlugin templates are warranted. > createPlugin - improve templates > > > Key: OFBIZ-13048 > URL: https://issues.apache.org/jira/browse/OFBIZ-13048 > Project: OFBiz > Issue Type: Improvement > Components: framework > Reporter: Pierre Smits >Priority: Major > Labels: development > > With the parameterization of the menu location, improvements to the > createPlugin templates are warranted. > replacing mining with script folder, to ensure developers have a place to > have their non-compiled script files (groovy and others). > Removing non English labels, as in coding English is the internationally used > language (and more particarly within the ASF communities). -- This message was sent by Atlassian Jira (v8.20.10#820010)
[jira] [Commented] (OFBIZ-13095) The non ASCII language in UiLabels.xml are not correctly handled during plugin creation
[ https://issues.apache.org/jira/browse/OFBIZ-13095?page=com.atlassian.jira.plugin.system.issuetabpanels:comment-tabpanel=17847660#comment-17847660 ] Pierre Smits commented on OFBIZ-13095: -- Hi [~jleroux], With pull request 778 re OFBIZ-13048, I already removed the ZH labels. > The non ASCII language in UiLabels.xml are not correctly handled during > plugin creation > --- > > Key: OFBIZ-13095 > URL: https://issues.apache.org/jira/browse/OFBIZ-13095 > Project: OFBiz > Issue Type: Sub-task > Components: Gradle >Affects Versions: 18.12.14 >Reporter: Jacques Le Roux >Assignee: Jacques Le Roux >Priority: Major > > You get this error: > 2024-05-19 09:52:41,314 |jsse-nio-8443-exec-3 |UtilProperties > |W| XML file for locale could not be loaded. > org.xml.sax.SAXParseException: Invalid byte 3 of 3-byte UTF-8 sequence. > When removing ZH labels it works. We should keep only English languages or > amend the createPlugin Gradle task. In this issue I'll remove ZH labels and > put a comment as documentation about that for developers in > framework/resources/templates/UiLabels.xml -- This message was sent by Atlassian Jira (v8.20.10#820010)
[jira] [Commented] (OFBIZ-12951) CommonExt - Move from hard-code menu location to parameterized
[ https://issues.apache.org/jira/browse/OFBIZ-12951?page=com.atlassian.jira.plugin.system.issuetabpanels:comment-tabpanel=17847600#comment-17847600 ] Pierre Smits commented on OFBIZ-12951: -- Hi Jacques, With the latest addition to the pull-request we can finally put the issue to rest. Adding a MainActionMenu to Menus.xml in ofbizsetup, that extends the same in PartyMenus.xml resolves the issue. Anyway, thank you for your time and diligence. > CommonExt - Move from hard-code menu location to parameterized > -- > > Key: OFBIZ-12951 > URL: https://issues.apache.org/jira/browse/OFBIZ-12951 > Project: OFBiz > Issue Type: Sub-task > Components: commonext >Affects Versions: Upcoming Branch >Reporter: Pierre Smits >Assignee: Jacques Le Roux >Priority: Major > Fix For: Upcoming Branch > > Attachments: Screenshot 2024-05-05 at 20.32.11.png, Screenshot > 2024-05-13 at 12.18.38.png > > > Move the menu location in the various commonest screens from hard-coded to > parameterized. -- This message was sent by Atlassian Jira (v8.20.10#820010)
[RFR2] po4a://manpages-fr/utimensat.2/po/fr/po
Bonjour, Le mercredi 15 mai 2024 à 13:06 +0200, bu...@no-log.org a écrit : > Bonjour, > > détails/suggestions (aussi, j'ai vu le mail de Lucien arriver, j'ai relu > 72%) > amicalement, > bubu Je renvoie le fichier avec les corrections suggérées par bubu et Lucien. Merci d'avance pour vos nouvelles relectures. Amicalement, jipege utimensat.2.po.tar.xz Description: application/xz-compressed-tar signature.asc Description: This is a digitally signed message part
[RFR2] po4a://manpages-fr/time.2/po/fr/po
Bonjour, Le mercredi 15 mai 2024 à 11:38 +0200, bu...@no-log.org a écrit : > Bonjour, > Ce fichier a été mis à jour. Merci d'avance pour vos relectures. > > des détails et suggestions, > amicalement, > bubu C'est corrigé (j'ai unifié EPOCH = époque POSIX) Merci d'avance pour vos nouvelles relectures. Amicalement jipege time.2.po.tar.xz Description: application/xz-compressed-tar signature.asc Description: This is a digitally signed message part
[DONE] po4a://manpages-fr/proc_pid_io.5/po/fr.po 14u
Bonjour, Le vendredi 10 mai 2024 à 18:51 +0200, Jean-Pierre Giraud a écrit : > Le samedi 04 mai 2024 à 14:35 +0200, Lucien Gentis a écrit : > > Le 04/05/2024 à 00:47, Jean-Pierre Giraud a écrit : > > > > Détails et suggestions > > Amicalement > > Lucien > Passage en LCFC. Je renvoie le fichier avec les corrections proposées par Terminé. Merci à Lucien pour sa relecture. Amicalement, jipege signature.asc Description: This is a digitally signed message part
[DONE] po4a://manpages-fr/prctl.2/po/fr.po f42 u7
Bonjour, Le vendredi 10 mai 2024 à 01:34 +0200, Jean-Pierre Giraud a écrit : > Le vendredi 19 avril 2024 à 10:25 +0200, JP Guillonneau a écrit : > > Bonjour, > > Le 18/04/24 17:50 Jean-Pierre a écrit : > > > Passage en LCFC. Je renvoie le texte avec les corrections suggérées par Terminé. Meric à Jean-Paul pour sa relecture. Amicalement, jipege signature.asc Description: This is a digitally signed message part
[jira] [Created] (OFBIZ-13093) Payment to Supplier with non default currency generates an error
Pierre Smits created OFBIZ-13093:
Summary: Payment to Supplier with non default currency generates
an error
Key: OFBIZ-13093
URL: https://issues.apache.org/jira/browse/OFBIZ-13093
Project: OFBiz
Issue Type: Bug
Components: accounting
Affects Versions: 18.12.13
Reporter: Pierre Smits
When creating a payment to a supplier that has a different currency than
default for the OFBiz setup (in demo stable: EuroSupplier, following error is
shown:
{code:java}
The Following Errors Occurred:Exception thrown while creating the "payment"
GenericValue: org.apache.ofbiz.entity.GenericEntityException: Error while
inserting:
[GenericEntity:Payment][amount,100(java.math.BigDecimal)][comments,paper
toner(java.lang.String)][createdStamp,2024-05-18
07:35:11.375(java.sql.Timestamp)][createdTxStamp,2024-05-18
07:35:11.35(java.sql.Timestamp)][currencyUomId,USD(java.lang.String)][effectiveDate,2024-05-18
07:35:11.375(java.sql.Timestamp)][lastUpdatedStamp,2024-05-18
07:35:11.375(java.sql.Timestamp)][lastUpdatedTxStamp,2024-05-18
07:35:11.35(java.sql.Timestamp)][overrideGlAccountId,null()][partyIdFrom,Company(java.lang.String)][partyIdTo,euro(java.lang.String)][paymentId,10001(java.lang.String)][paymentMethodId,ABN_CHECKING(java.lang.String)][paymentMethodTypeId,COMPANY_CHECK(java.lang.String)][paymentRefNum,1(java.lang.String)][paymentTypeId,VENDOR_PAYMENT(java.lang.String)][statusId,PMNT_NOT_PAID(java.lang.String)]
(SQL Exception while executing the following:INSERT INTO OFBIZ.PAYMENT
(PAYMENT_ID, PAYMENT_TYPE_ID, PAYMENT_METHOD_TYPE_ID, PAYMENT_METHOD_ID,
PAYMENT_GATEWAY_RESPONSE_ID, PAYMENT_PREFERENCE_ID, PARTY_ID_FROM, PARTY_ID_TO,
ROLE_TYPE_ID_TO, STATUS_ID, EFFECTIVE_DATE, PAYMENT_REF_NUM, AMOUNT,
CURRENCY_UOM_ID, COMMENTS, FIN_ACCOUNT_TRANS_ID, OVERRIDE_GL_ACCOUNT_ID,
ACTUAL_CURRENCY_AMOUNT, ACTUAL_CURRENCY_UOM_ID, LAST_UPDATED_STAMP,
LAST_UPDATED_TX_STAMP, CREATED_STAMP, CREATED_TX_STAMP) VALUES (?, ?, ?, ?, ?,
?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?) (INSERT on table
'PAYMENT' caused a violation of foreign key constraint 'PAYMENT_TPTY' for key
(euro). The statement has been rolled back.)) (Error while inserting:
[GenericEntity:Payment][amount,100(java.math.BigDecimal)][comments,paper
toner(java.lang.String)][createdStamp,2024-05-18
07:35:11.375(java.sql.Timestamp)][createdTxStamp,2024-05-18
07:35:11.35(java.sql.Timestamp)][currencyUomId,USD(java.lang.String)][effectiveDate,2024-05-18
07:35:11.375(java.sql.Timestamp)][lastUpdatedStamp,2024-05-18
07:35:11.375(java.sql.Timestamp)][lastUpdatedTxStamp,2024-05-18
07:35:11.35(java.sql.Timestamp)][overrideGlAccountId,null()][partyIdFrom,Company(java.lang.String)][partyIdTo,euro(java.lang.String)][paymentId,10001(java.lang.String)][paymentMethodId,ABN_CHECKING(java.lang.String)][paymentMethodTypeId,COMPANY_CHECK(java.lang.String)][paymentRefNum,1(java.lang.String)][paymentTypeId,VENDOR_PAYMENT(java.lang.String)][statusId,PMNT_NOT_PAID(java.lang.String)]
(SQL Exception while executing the following:INSERT INTO OFBIZ.PAYMENT
(PAYMENT_ID, PAYMENT_TYPE_ID, PAYMENT_METHOD_TYPE_ID, PAYMENT_METHOD_ID,
PAYMENT_GATEWAY_RESPONSE_ID, PAYMENT_PREFERENCE_ID, PARTY_ID_FROM, PARTY_ID_TO,
ROLE_TYPE_ID_TO, STATUS_ID, EFFECTIVE_DATE, PAYMENT_REF_NUM, AMOUNT,
CURRENCY_UOM_ID, COMMENTS, FIN_ACCOUNT_TRANS_ID, OVERRIDE_GL_ACCOUNT_ID,
ACTUAL_CURRENCY_AMOUNT, ACTUAL_CURRENCY_UOM_ID, LAST_UPDATED_STAMP,
LAST_UPDATED_TX_STAMP, CREATED_STAMP, CREATED_TX_STAMP) VALUES (?, ?, ?, ?, ?,
?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?) (INSERT on table
'PAYMENT' caused a violation of foreign key constraint 'PAYMENT_TPTY' for key
(euro). The statement has been rolled back.))) {code}
--
This message was sent by Atlassian Jira
(v8.20.10#820010)
[jira] [Comment Edited] (OFBIZ-12951) CommonExt - Move from hard-code menu location to parameterized
[ https://issues.apache.org/jira/browse/OFBIZ-12951?page=com.atlassian.jira.plugin.system.issuetabpanels:comment-tabpanel=17847264#comment-17847264 ] Pierre Smits edited comment on OFBIZ-12951 at 5/18/24 6:55 AM: --- HI [~jleroux] , with the latest update to PR#795, the issue in demo-trunk is now fixed. was (Author: pfm.smits): HI [~jleroux] , with the latest update to PR#79, the issue in demo-trunk is now fixed. > CommonExt - Move from hard-code menu location to parameterized > -- > > Key: OFBIZ-12951 > URL: https://issues.apache.org/jira/browse/OFBIZ-12951 > Project: OFBiz > Issue Type: Sub-task > Components: commonext >Affects Versions: Upcoming Branch >Reporter: Pierre Smits >Assignee: Jacques Le Roux >Priority: Major > Fix For: Upcoming Branch > > Attachments: Screenshot 2024-05-05 at 20.32.11.png, Screenshot > 2024-05-13 at 12.18.38.png > > > Move the menu location in the various commonest screens from hard-coded to > parameterized. -- This message was sent by Atlassian Jira (v8.20.10#820010)
Re: maven-debian-helper: dependency org.kohsuke github-api not found
Hello Tobias, Le 17/05/2024 à 15:39, Tobias Hilbricht a écrit : Dear readers, as my first packaging project I try to package the Zettelkasten Zkn3 app https://github.com/Zettelkasten-Team/Zettelkasten/tree/main and can build it successfully with maven on Debian bookworm. However, trying to package it in a deb with mh_helper, I get this message: In pom.xml: This dependency cannot be found in the Debian Maven repository. Ignore this dependency? org.kohsuke:github-api:jar:1.117 [y/N] > dpkg --search /usr/share/maven-repo/org/kohsuke/github-api/*/* dpkg failed to execute successfully apt-file search /usr/share/maven-repo/org/kohsuke/github-api apt-file failed to execute successfully dpkg --search /usr/share/java/github-api.jar dpkg failed to execute successfully apt-file search /usr/share/java/github-api.jar Found perl Found perl Found perl apt-file failed to execute successfully [error] Package perl does not contain Maven dependency org.kohsuke:github-api:jar:1.117 but there seem to be a match If the package contains already Maven artifacts but the names don't match, try to enter a substitution rule of the form s/groupId/newGroupId/ s/artifactId/newArtifactId/ jar s/version/newVersion/ here: Using the suggestions here https://wiki.debian.org/Java/Packaging/FAQ I do not find a corresponding debian package, but on maven it exists: https://mvnrepository.com/artifact/org.kohsuke/github-api That's right, this artifact is not packaged in Debian. One possibility is to package it if it is really needed. However, I think you can skip it for your build, the classes of org.kohsuke:github-api do not seem to be used anywhere in the software you are interested in. You can simply get rid of this dependency by adding the line org.kohsuke github-api * * * * to the file debian/maven.ignoreRules (create it, if needed). Make sure you read https://wiki.debian.org/Java/MavenDebianHelper and the examples at https://wiki.debian.org/Java/Packaging/Maven Also you can look at the sources of other Debian packages using Maven, e.g. junit4, biojava6-live, libdistlib-java, ... to see more examples. Possibly you will meet other unpackaged artifacts in the dependencies of Zettelkasten, in which case it is good to look at how their classes are used. If not at all, ignoring the artifact as done above is safe. How can I satisfy the dependency in a Debian way? Thanks for helpful pointers Tobias Best, -- Pierre OpenPGP_signature.asc Description: OpenPGP digital signature
[RFR2] wml://devel/wnpp/index.wml
Bonjour, Le mercredi 15 mai 2024 à 11:12 +0200, JP Guillonneau a écrit : > Bonjour, > Le 14/05/24 10:05 Jean-Pierre a écrit : > > Ce fichier a été mis à jour. Merci d'avance pour vos relectures. > Suggestions. > Amicalement Voici une version avec les corrections suggérées par Jean-Paul à l'exception de "paquets en cours d'adoption" Merci d'avance pour vos nouvelles relectures. Amicalement, jipege index.wml.tar.xz Description: application/xz-compressed-tar signature.asc Description: This is a digitally signed message part
[jira] [Resolved] (NIFI-12226) Maven plugin: Add flag to skip doc generation
[ https://issues.apache.org/jira/browse/NIFI-12226?page=com.atlassian.jira.plugin.system.issuetabpanels:all-tabpanel ] Pierre Villard resolved NIFI-12226. --- Fix Version/s: nifi-nar-maven-plugin-1.5.2 Resolution: Fixed > Maven plugin: Add flag to skip doc generation > - > > Key: NIFI-12226 > URL: https://issues.apache.org/jira/browse/NIFI-12226 > Project: Apache NiFi > Issue Type: Improvement >Reporter: Nicolò Boschi >Priority: Minor > Fix For: nifi-nar-maven-plugin-1.5.2 > > Time Spent: 1h > Remaining Estimate: 0h > > In [LangStream/langstream|https://github.com/LangStream/langstream] we use > this plugin for producing NAR files. The NAR are then ingested by the > LangStream runtime and the documentation is not needed. -- This message was sent by Atlassian Jira (v8.20.10#820010)
[jira] [Updated] (NIFI-13258) NAR Plugin - add parameter providers and flow analysis rules extension types
[ https://issues.apache.org/jira/browse/NIFI-13258?page=com.atlassian.jira.plugin.system.issuetabpanels:all-tabpanel ] Pierre Villard updated NIFI-13258: -- Status: Patch Available (was: Open) > NAR Plugin - add parameter providers and flow analysis rules extension types > > > Key: NIFI-13258 > URL: https://issues.apache.org/jira/browse/NIFI-13258 > Project: Apache NiFi > Issue Type: Improvement > Components: Tools and Build > Reporter: Pierre Villard >Assignee: Pierre Villard >Priority: Major > Fix For: nifi-nar-maven-plugin-1.5.2 > > Time Spent: 10m > Remaining Estimate: 0h > > Improve the NiFi NAR Maven plugin to add Parameter Providers and Flow > Analysis Rules in the extension types. -- This message was sent by Atlassian Jira (v8.20.10#820010)
[jira] [Created] (NIFI-13258) NAR Plugin - add parameter providers and flow analysis rules extension types
Pierre Villard created NIFI-13258: - Summary: NAR Plugin - add parameter providers and flow analysis rules extension types Key: NIFI-13258 URL: https://issues.apache.org/jira/browse/NIFI-13258 Project: Apache NiFi Issue Type: Improvement Components: Tools and Build Reporter: Pierre Villard Assignee: Pierre Villard Fix For: nifi-nar-maven-plugin-1.5.2 Improve the NiFi NAR Maven plugin to add Parameter Providers and Flow Analysis Rules in the extension types. -- This message was sent by Atlassian Jira (v8.20.10#820010)
Re: [H-S] typo dans sed.1.po
Bonjour, Le vendredi 17 mai 2024 à 12:43 +0200, bu...@no-log.org a écrit : > Bonjour, > > Je viens de voir un reliquat dans la page de sed ; voir le diff. > > Ma question est : cela vaut-il la peine de lancer un RFR pour un détail > de ce genre (ne nécessitant pas spécialement de relectures), je me dis > qu'un coup de blanco de la part de Jean Pierre sur le git arrangera tout, > je m'étais déjà posé la question pour le x de exclude dans grep... > > Amicalement, > bubu C'est corrigé + un accent circonflexe baladeur... Je partage ton avis : si vous avez des détails insignifiants à corriger, vous pouvez les signaler sur la liste. Cela prend 3 minutes à corriger. Amicalement, jipege signature.asc Description: This is a digitally signed message part
[jira] [Commented] (OFBIZ-12951) CommonExt - Move from hard-code menu location to parameterized
[ https://issues.apache.org/jira/browse/OFBIZ-12951?page=com.atlassian.jira.plugin.system.issuetabpanels:comment-tabpanel=17847264#comment-17847264 ] Pierre Smits commented on OFBIZ-12951: -- HI [~jleroux] , with the latest update to PR#79, the issue in demo-trunk is now fixed. > CommonExt - Move from hard-code menu location to parameterized > -- > > Key: OFBIZ-12951 > URL: https://issues.apache.org/jira/browse/OFBIZ-12951 > Project: OFBiz > Issue Type: Sub-task > Components: commonext >Affects Versions: Upcoming Branch >Reporter: Pierre Smits >Assignee: Jacques Le Roux >Priority: Major > Fix For: Upcoming Branch > > Attachments: Screenshot 2024-05-05 at 20.32.11.png, Screenshot > 2024-05-13 at 12.18.38.png > > > Move the menu location in the various commonest screens from hard-coded to > parameterized. -- This message was sent by Atlassian Jira (v8.20.10#820010)
Re: [GNC] Continued blank reports from within gnucash, printed version looks fine
I experienced the same blank report running Linux Mint 21.3 after an update introduced after April 26. I restored my system using Timeshift with a snapshot of April 26 and the reports are no longer blank. Will wait for a fix before updating again. I I have GNUCASH version 5.6 Build ID Flathub 5.6-1 under Linux Mint 21.3. Hopefully this will help the great developers behind GNUCASH in identifying the root cause. On Fri, May 17, 2024 at 7:22 AM Daffy Duck wrote: > I just upgraded to Fedora 40, cinnamon, and continue to have blank > reports and invoices from within gnucash, but when printed to PDF, they > look fine. > > I've tried some other themes in Cinnamon, but it appears the same > thing. > > I've attached a sample of what I mean: > > > How do I fix this? The data is there, because when I print to PDF, the > file looks fine. > ___ > gnucash-user mailing list > gnucash-user@gnucash.org > To update your subscription preferences or to unsubscribe: > https://lists.gnucash.org/mailman/listinfo/gnucash-user > - > Please remember to CC this list on all your replies. > You can do this by using Reply-To-List or Reply-All. > ___ gnucash-user mailing list gnucash-user@gnucash.org To update your subscription preferences or to unsubscribe: https://lists.gnucash.org/mailman/listinfo/gnucash-user - Please remember to CC this list on all your replies. You can do this by using Reply-To-List or Reply-All.
Re: [discuss] What to do with the Cassandra components
Hey guys, what's the latest on this? Le sam. 23 mars 2024 à 01:49, Mike Thomsen a écrit : > Fair enough, Joe. > > Matt, > > I poked around your branch a little this evening. I agree with you and > David 100% now on the need for some sort of abstraction. I think the Graph > Bundle's model could serve as a good starting point for how to approach the > problem. The client drivers in that bundle do the heavy lifting of doing > the querying and passing the results back via a callback system to the > processors that call them to ensure that the processors don't know anything > other than they're getting back a Map of result data each iteration. > Thoughts? > > On Fri, Mar 22, 2024 at 2:48 PM Joe Witt wrote: > > > Mike, > > > > The bundles we include cannot have libs with know vulns and that last a > > very long time. That is a more pressing blocker. > > > > As noted top of thread we all recognize the importance of being able to > > integrate with Cassandra but including that must come with active mx > > especially as it relates to vulns. > > > > Thanks > > Joe > > > > On Fri, Mar 22, 2024 at 11:42 AM Mike Thomsen > > wrote: > > > > > The scope tag was probably copy pasta. You raise a valid point about > the > > > processor dependencies that completely slipped my mind. That said, I > > think > > > it's premature to remove the cassandra bundle until we have a working > > > replacement. I would consider that support a blocker for 2.X. > > > > > > On Fri, Mar 22, 2024 at 12:00 PM Matt Burgess > > wrote: > > > > > > > David beat me to it :) IMO the only NAR that should have any > > dependencies > > > > on Cassandra is the services NAR, not the processors or services API. > > > > > > > > On Fri, Mar 22, 2024 at 11:10 AM David Handermann < > > > > exceptionfact...@apache.org> wrote: > > > > > > > > > Mike, > > > > > > > > > > Thanks for sharing the branch, it is helpful to have that as a > > > > > reference example. Have you been able to exercise any of that > > approach > > > > > at runtime? > > > > > > > > > > Based on what is there right now, attempting to mark the DataStax > > > > > java-driver-core as provided does not look like it will work. It > may > > > > > pass unit tests, but runtime NAR class loading requires that > classes > > > > > be available in the same NAR, or in a parent NAR. That means when > > NiFi > > > > > tries to load the Controller Service interface, it must have access > > to > > > > > a version of the relevant Cassandra driver classes. By marking the > > > > > dependency as provided, it will not be available in the API NAR, > and > > > > > thus not available when loading the service interface. Including it > > in > > > > > the API NAR won't work either, because it conflicts with the > ScyllaDB > > > > > java-driver-core in the implementation NAR. > > > > > > > > > > This is the reason Matt and I highlighted for providing a layer of > > > > > abstraction at the Controller Service API level. > > > > > > > > > > Regards, > > > > > David Handermann > > > > > > > > > > On Fri, Mar 22, 2024 at 8:13 AM Mike Thomsen < > mikerthom...@gmail.com > > > > > > > > wrote: > > > > > > > > > > > > Work so far: > https://github.com/MikeThomsen/nifi/tree/cql-changes > > > > > > > > > > > > On Thu, Mar 21, 2024 at 9:52 AM Mike Thomsen < > > mikerthom...@gmail.com > > > > > > > > > wrote: > > > > > > > > > > > > > Matt/David, > > > > > > > > > > > > > > By this evening, I should be at a point where I can share my > > > branch. > > > > It > > > > > > > should be far enough along that y'all can see what I mean about > > how > > > > > most of > > > > > > > the changes really weren't that complicated. My sense is that > if > > we > > > > > > > collaborate on it, we can probably get it ready for a PR > within a > > > > week > > > > > or > > > > > > > two. > > > > > > > > > > > > > > It would probably be a good idea to plan to revisit the > Cassandra > > > > DMC's > > > > > > > design and make it more flexible. > > > > > > > > > > > > > > One nice thing about the new DataStax driver is that it > supports > > > > > > > configuration by a very detailed configuration file format, so > we > > > can > > > > > give > > > > > > > users that option + combine it with EL/parameters (I envision > an > > > > option > > > > > > > where the user puts EL in the file, we load the file, > preprocess > > > the > > > > > EL and > > > > > > > load that into the driver) > > > > > > > > > > > > > > On Wed, Mar 20, 2024 at 4:01 PM Mike Thomsen < > > > mikerthom...@gmail.com > > > > > > > > > > > > wrote: > > > > > > > > > > > > > >> If it were that simple, they would probably have just gone > with > > > that > > > > > > >> solution. That said, the API is functionally vendor agnostic > at > > > this > > > > > point > > > > > > >> at the Java API level. So I see no need to add abstraction > above > > > > > that. I've > > > > > > >> got probably 2/3 of nifi-cassandra-bundle converted. Hitting a > > few > > > > > pain > > > > > > >>
[clang] [llvm] [AMDGPU] Add amdgpu-as MMRA for fences (PR #78572)
Pierre-vh wrote: @arsenm Should we use `image` or `private`? We could allow both in the frontend, and only use `private` as the canonical MMRA. https://github.com/llvm/llvm-project/pull/78572 ___ cfe-commits mailing list cfe-commits@lists.llvm.org https://lists.llvm.org/cgi-bin/mailman/listinfo/cfe-commits
Re: Problème après mise à jour: la machine ne sort plus de veille.
Hello, Charles Plessy wrote on 15/05/2024 at 11:12:52+0200: > Bonjour à tous, > > désolé pour la rafale de messages mais c'est un peu la cata… > > Aujourd'hui j'ai redémarré mon portable et depuis il ne sort plus de > veille après qu'il y soit entré. Plus précisément, ni le clavier ni la > souris ne se réveillent, et je n'ai pas d'autre choix que de redémarrer > complètement la machine.. J'avais eu ce problème depuis le début et la > solution suivante trouvée par un autre utilisateur avait réglé le > problème: > > Mettre dans /usr/lib/systemd/system-sleep: > > case $1/$2 in > pre/*) > ;; > post/*) > echo -n reconnect > /sys/devices/platform/i8042/serio0/drvctl > echo -n reconnect > /sys/devices/platform/i8042/serio2/drvctl > ;; > esac > > Je suis sous Bookworm et je ne sais pas très bien commment attaquer le > problème. J'ai essayé de redémarrer sous linux-image-6.1.0-20-amd64 > mais ça ne résoud rien. Je n'avais pas redémarré depuis longtemps, et > j'ai perdu la trace de ce qui a pu être mis à jour récemment (à part > bien sûr la glib qui m'avait fait perdre le support du japonais et du > chinois dans Firefox…). > > La machine est un VAIO Pro 13 vieux de 9 ans environ… > > Si vous avez de idées, je suis preneur ! > > Bonne journée, Du bruit dans le dmesg? -- PEB signature.asc Description: PGP signature
Re: Request to join Debian Python Team
Hi, Maytham Alsudany wrote on 15/05/2024 at 11:37:19+0200: > Hi DPT, > > I'm requesting to join the Debian Python Team in order to maintain some > new packages under the team, such "nwg-clipman"[1], as well as moving > "nwg-hello"[2] to team maintenance. (I also may look into packaging > "plots"[3] in the long term.) > > My Salsa username is "Maytha8". > > I have read > https://salsa.debian.org/python-team/tools/python-modules/blob/master/policy.rst > and I accept it. > > Thanks, Developer access granted to the group. Welcome! -- PEB signature.asc Description: PGP signature
Re: Sean Farley 1983 - 2024
As the most alert of you quickly noticed… the funeral ceremony is on July 20th (in two months) instead of May 20th (in 4 days). The Memorial date of May 25th in San Francisco is correct. Sorry for the confusion. On 5/16/24 22:09, Pierre-Yves David wrote: Hello community members, It is with great sadness that we learned last week that Sean Farley passed away at the beginning of this month. Sean was part of the Mercurial community for a long time and a friend to some of its members. Through direct contributions and his work at Bitbucket, he helped to shape Mercurial into a better tool and project. His funeral will be held next Monday (May 20th) In Monroe, Louisiana¹. In addition, a memorial event² will be held in San Francisco the Saturday after (May 25th). For those who would like a chance to honor his memory and contributions to this project, I am offering to gather farewell messages and memories from the community. To contribute, reply to this message either publicly or privately and I will transfer them to his relatives before the funeral. Sean was a dear friend to me. My thoughts are with his sister and his partner in these difficult times. Regards, -- Pierre-Yves David [1] Louisiana funeral details: https://www.facebook.com/events/728972396090009/ [2] San Francisco memorial event: https://facebook.com/events/s/celebration-of-sean-farleys-li/428464819934258/ ___ Mercurial-devel mailing list Mercurial-devel@lists.mercurial-scm.org https://lists.mercurial-scm.org/mailman/listinfo/mercurial-devel -- Pierre-Yves David ___ Mercurial-devel mailing list Mercurial-devel@lists.mercurial-scm.org https://lists.mercurial-scm.org/mailman/listinfo/mercurial-devel
Sean Farley 1983 - 2024
Hello community members, It is with great sadness that we learned last week that Sean Farley passed away at the beginning of this month. Sean was part of the Mercurial community for a long time and a friend to some of its members. Through direct contributions and his work at Bitbucket, he helped to shape Mercurial into a better tool and project. His funeral will be held next Monday (May 20th) In Monroe, Louisiana¹. In addition, a memorial event² will be held in San Francisco the Saturday after (May 25th). For those who would like a chance to honor his memory and contributions to this project, I am offering to gather farewell messages and memories from the community. To contribute, reply to this message either publicly or privately and I will transfer them to his relatives before the funeral. Sean was a dear friend to me. My thoughts are with his sister and his partner in these difficult times. Regards, -- Pierre-Yves David [1] Louisiana funeral details: https://www.facebook.com/events/728972396090009/ [2] San Francisco memorial event: https://facebook.com/events/s/celebration-of-sean-farleys-li/428464819934258/ ___ Mercurial-devel mailing list Mercurial-devel@lists.mercurial-scm.org https://lists.mercurial-scm.org/mailman/listinfo/mercurial-devel
Sean Farley 1983 - 2024
Hello community members, It is with great sadness that we learned last week that Sean Farley passed away at the beginning of this month. Sean was part of the Mercurial community for a long time and a friend to some of its members. Through direct contributions and his work at Bitbucket, he helped to shape Mercurial into a better tool and project. His funeral will be held next Monday (May 20th) In Monroe, Louisiana¹. In addition, a memorial event² will be held in San Francisco the Saturday after (May 25th). For those who would like a chance to honor his memory and contributions to this project, I am offering to gather farewell messages and memories from the community. To contribute, reply to this message either publicly or privately and I will transfer them to his relatives before the funeral. Sean was a dear friend to me. My thoughts are with his sister and his partner in these difficult times. Regards, -- Pierre-Yves David [1] Louisiana funeral details: https://www.facebook.com/events/728972396090009/ [2] San Francisco memorial event: https://facebook.com/events/s/celebration-of-sean-farleys-li/428464819934258/ ___ Mercurial mailing list Mercurial@lists.mercurial-scm.org https://lists.mercurial-scm.org/mailman/listinfo/mercurial
[jira] [Resolved] (NIFI-13256) Python WriteHelloWorld Example has Incorrect Attributes
[ https://issues.apache.org/jira/browse/NIFI-13256?page=com.atlassian.jira.plugin.system.issuetabpanels:all-tabpanel ] Pierre Villard resolved NIFI-13256. --- Fix Version/s: 2.0.0-M4 Resolution: Fixed > Python WriteHelloWorld Example has Incorrect Attributes > --- > > Key: NIFI-13256 > URL: https://issues.apache.org/jira/browse/NIFI-13256 > Project: Apache NiFi > Issue Type: Bug > Components: Documentation Website >Affects Versions: 2.0.0-M2 >Reporter: David Handermann >Assignee: David Handermann >Priority: Minor > Fix For: 2.0.0-M4 > > Time Spent: 20m > Remaining Estimate: 0h > > The Python Developer Guide includes an example WriteHelloWorld Processor > which defines a set instead of a dictionary for FlowFile attributes. -- This message was sent by Atlassian Jira (v8.20.10#820010)
Re: [VOTE] Release Apache NiFi 2.0.0-M3 (RC1)
+1 (binding) Went through the usual steps, deployed a secured cluster with a secured NiFi Registry instance on GCP and tested a bunch of flows that I have around. Thanks for RM'ing David! Le jeu. 16 mai 2024 à 15:26, Matt Burgess a écrit : > +1 (binding) > > Ran through release helper, verified various flows. Thanks for RM'ing > David! > > On Mon, May 13, 2024 at 11:48 PM David Handermann < > exceptionfact...@apache.org> wrote: > > > Team, > > > > I am pleased to be calling this vote for the source release of Apache > > NiFi 2.0.0-M3. > > > > Please review the following guide for how to verify a release candidate > > build: > > > > > > > https://cwiki.apache.org/confluence/display/NIFI/Release+Candidate+Verification > > > > The source being voted on and the convenience binaries are available > > on the Apache Distribution Repository: > > > > https://dist.apache.org/repos/dist/dev/nifi/nifi-2.0.0-M3 > > > > The build artifacts are available on the Apache Nexus Repository: > > > > https://repository.apache.org/content/repositories/orgapachenifi-1269 > > > > Git Tag: nifi-2.0.0-M3-RC1 > > Git Commit ID: f2215c6522a5571189290760c55f0317f8562cbd > > GitHub Commit Link: > > > > > https://github.com/apache/nifi/commit/f2215c6522a5571189290760c55f0317f8562cbd > > > > Checksums of nifi-2.0.0-M3-source-release.zip > > > > SHA256: d471a0a9e4e04faf13bbe13c7d83be6f8002fba598bf0968a3c1b339802a185a > > SHA512: > > > cd0b8bbd3fe4ea7ebe8cdac6ac8a7afa97fd7b6a521c2cbcb2c0cdc94899b652bf3726c8fe432e16f44a9dc81907414bbb42e03113f0cd9fb51aa1de9cd727a7 > > > > Release artifacts are signed with the following key: > > > > https://people.apache.org/keys/committer/exceptionfactory.asc > > > > KEYS file is available on the Apache Distribution Repository: > > > > https://dist.apache.org/repos/dist/release/nifi/KEYS > > > > Issues resolved for this version: 411 > > > > > > > https://issues.apache.org/jira/secure/ReleaseNote.jspa?projectId=12316020=12354155 > > > > Release note highlights can be found on the project wiki: > > > > > > > https://cwiki.apache.org/confluence/display/NIFI/Release+Notes#ReleaseNotes-Version2.0.0-M3 > > > > The vote will be open for 72 hours. > > > > Please download the release candidate and evaluate the necessary items > > including checking hashes, signatures, build from source, and test. > > Then please vote: > > > > [] +1 Release this package as nifi-2.0.0-M3 > > [] +0 no opinion > > [] -1 Do not release this package because... > > >
Re: [VOTE] Release Apache NiFi MiNiFi C++ 0.99.0 (RC4)
+1 (binding) Went through the usual steps Built on MacOS X. Tested a basic flow tailing a local file, doing some transformations and sending data with InvokeHTTP to a NiFi instance with FlowFile format. Thanks team for taking care of this release and the exciting upcoming 1.0. Le mer. 15 mai 2024 à 17:30, Ferenc Gerlits a écrit : > +1 (non-binding) > > verified signature and hashes > installed the Windows MSI and ran the service on Windows > compiled on Fedora 40 and ran ExecuteScript with lua > > It mostly worked as expected. I found two minor issues: > https://issues.apache.org/jira/browse/MINIFICPP-2374, > https://issues.apache.org/jira/browse/MINIFICPP-2375, but neither of > these is a showstopper, we'll fix them in the next release. > > Thank you for RMing! > Ferenc >
[Bug 2065925] [NEW] connexion to server lost
Public bug reported: After upgrade from 22.04 to 24.04 the freeorion server does not work anymore. I tried to erease the profile, I tried to use a different user. I tried to purge and install again freeorion, the problem is stil there. Freeorion works well when connecting to a multiplayer game if the server is on another machine. ProblemType: Bug DistroRelease: Ubuntu 24.04 Package: freeorion 0.5+git20230820-4build5 ProcVersionSignature: Ubuntu 6.8.0-31.31-generic 6.8.1 Uname: Linux 6.8.0-31-generic x86_64 ApportVersion: 2.28.1-0ubuntu3 Architecture: amd64 CasperMD5CheckResult: unknown CurrentDesktop: ubuntu:GNOME Date: Thu May 16 17:41:59 2024 InstallationDate: Installed on 2021-04-17 (1125 days ago) InstallationMedia: Ubuntu 20.04.2.0 LTS "Focal Fossa" - Release amd64 (20210209.1) ProcEnviron: LANG=fr_FR.UTF-8 PATH=(custom, no user) SHELL=/bin/bash TERM=xterm-256color XDG_RUNTIME_DIR= SourcePackage: freeorion UpgradeStatus: Upgraded to noble on 2024-05-02 (14 days ago) ** Affects: freeorion (Ubuntu) Importance: Undecided Status: New ** Tags: amd64 apport-bug noble wayland-session -- You received this bug notification because you are a member of Ubuntu Bugs, which is subscribed to Ubuntu. https://bugs.launchpad.net/bugs/2065925 Title: connexion to server lost To manage notifications about this bug go to: https://bugs.launchpad.net/ubuntu/+source/freeorion/+bug/2065925/+subscriptions -- ubuntu-bugs mailing list ubuntu-bugs@lists.ubuntu.com https://lists.ubuntu.com/mailman/listinfo/ubuntu-bugs
Re: \once squashedPosition = 100 ('O_o!)
What‽ How in the world could I have not found this for myself… So much shame. Thank you Timothy :-) Le jeu. 16 mai 2024, à 10 h 16, Timothy Lanfear a écrit : > > On 16/05/2024 14:56, Pierre-Luc Gauthier wrote: > > Hello there, > > Is it possible to \override the squashedPosition e.g. \once ? > > Yes, \once \set squashedPosition = #4 > > -- > Timothy Lanfear, Bristol, UK. -- Pierre-Luc Gauthier
\once squashedPosition = 100 ('O_o!)
Hello there,
Is it possible to \override the squashedPosition e.g. \once ?
\version "2.25.15"
\layout {
\context {
\Voice
\consists "Pitch_squash_engraver"
%squashedPosition = #0
}
}
{
%\improvisationOff
c'4 c'
\improvisationOn
c'
\once \override Voice.squashedPosition = #4
c'
\improvisationOff
c'
}
The ML archive did not provide much help.
--
Pierre-Luc Gauthier
Re: [FRnOG] [TECH] Forticlient, Linux et OpenSSL
Le 16/05/2024 à 13:35, Dominique Rousseau a écrit : Le Thu, May 16, 2024 at 12:30:28PM +0200, Pierre DOLIDON [sn...@sn4ky.net] a écrit: Le 16/05/2024 à 11:14, Dominique Rousseau a écrit : Il faut récupérer initialement le certificat (ça se fait directement avec la commande openfortivpn ) et mettre l'empreinte dans le fichier de configuration. aurais tu un exemple à ce sujet ? Je galère de mon côté... et ai poussé le client a monter un tunnel VPN L2L (parceque en plus, le besoin de L2L est bien là) mais en attendant, côté FG le CN et le FQDN changent tous les mois (oui oui) et sont pas résolvables, et j'en ai marre de bricoler Si tu ne l'as pas autrement, de memoire, il "suffit" de préparer le fichier de configuration avec tout ce que tu veux *sauf* le 'trusted-cert', et quand tu le lances, ça te donne une erreur avec l'empreinte vue. Peut-etre avec un « -v » ah oui, on est d'accord, c'est bien de ça que je parlais en partie "bricolage" :-) --- Liste de diffusion du FRnOG http://www.frnog.org/
Re: [FRnOG] [TECH] Forticlient, Linux et OpenSSL
Le 16/05/2024 à 11:14, Dominique Rousseau a écrit : Il faut récupérer initialement le certificat (ça se fait directement avec la commande openfortivpn ) et mettre l'empreinte dans le fichier de configuration. aurais tu un exemple à ce sujet ? Je galère de mon côté... et ai poussé le client a monter un tunnel VPN L2L (parceque en plus, le besoin de L2L est bien là) mais en attendant, côté FG le CN et le FQDN changent tous les mois (oui oui) et sont pas résolvables, et j'en ai marre de bricoler merci =) --- Liste de diffusion du FRnOG http://www.frnog.org/
[med-svn] [Git][med-team/htsjdk][master] 3 commits: Raising Standards version to 4.7.0 (no change)
Pierre Gruet pushed to branch master at Debian Med / htsjdk Commits: c24b7734 by Pierre Gruet at 2024-05-15T21:56:44+02:00 Raising Standards version to 4.7.0 (no change) - - - - - ac9f152a by Pierre Gruet at 2024-05-15T22:00:59+02:00 Updating autopkgtest linked to drop-seq after changes in this package - - - - - 5532e2d6 by Pierre Gruet at 2024-05-15T22:01:10+02:00 Upload to unstable - - - - - 3 changed files: - debian/changelog - debian/control - debian/tests/drop-seq-run-unit-test Changes: = debian/changelog = @@ -1,3 +1,10 @@ +htsjdk (4.1.0+dfsg-2) unstable; urgency=medium + + * Raising Standards version to 4.7.0 (no change) + * Updating autopkgtest linked to drop-seq after changes in this package + + -- Pierre Gruet Wed, 15 May 2024 22:01:02 +0200 + htsjdk (4.1.0+dfsg-1) unstable; urgency=medium * New upstream version 4.1.0+dfsg = debian/control = @@ -28,7 +28,7 @@ Build-Depends: default-jdk, libcommons-lang3-java, libjimfs-java, scala-library -Standards-Version: 4.6.2 +Standards-Version: 4.7.0 Vcs-Browser: https://salsa.debian.org/med-team/htsjdk Vcs-Git: https://salsa.debian.org/med-team/htsjdk.git Homepage: https://samtools.github.io/htsjdk/ = debian/tests/drop-seq-run-unit-test = @@ -21,25 +21,8 @@ gunzip -r ref/* gunzip -r org/broadinstitute/dropseq/annotation/* gunzip -r org/broadinstitute/dropseq/readtrimming/* mkdir out -#do_stuff_to_test_package# echo -e "\e[93m\e[1mTest 1\e[0m" -drop-seq TagBamWithReadSequenceExtended INPUT=org/broadinstitute/dropseq/annotation/test.bam \ -OUTPUT=out/TagBamWithReadSequenceExtended-cellular.bam SUMMARY=TagBamWithReadSequenceExtended-cellular.bam_summary.txt BASE_RANGE=1-12 BASE_QUALITY=10 BARCODED_READ=1 DISCARD_READ=false TAG_NAME=XC NUM_BASES_BELOW_QUALITY=1 -samtools view out/TagBamWithReadSequenceExtended-cellular.bam > out/TagBamWithReadSequenceExtended-cellular.sam -diff out/TagBamWithReadSequenceExtended-cellular.sam ref/TagBamWithReadSequenceExtended-cellular.sam -echo -e "\e[92m\e[1mPassed\e[0m" -echo - -echo -e "\e[93m\e[1mTest 2\e[0m" -drop-seq TagBamWithReadSequenceExtended INPUT=org/broadinstitute/dropseq/annotation/test.bam \ -OUTPUT=out/TagBamWithReadSequenceExtended-molecular.bam SUMMARY=TagBamWithReadSequenceExtended-molecular.bam_summary.txt BASE_RANGE=1-12 BASE_QUALITY=10 BARCODED_READ=1 DISCARD_READ=false TAG_NAME=XM NUM_BASES_BELOW_QUALITY=1 -samtools view out/TagBamWithReadSequenceExtended-molecular.bam > out/TagBamWithReadSequenceExtended-molecular.sam -diff out/TagBamWithReadSequenceExtended-molecular.sam ref/TagBamWithReadSequenceExtended-molecular.sam -echo -e "\e[92m\e[1mPassed\e[0m" -echo - -echo -e "\e[93m\e[1mTest 3\e[0m" drop-seq FilterBam TAG_REJECT=XQ INPUT=org/broadinstitute/dropseq/readtrimming/N701.subset.tagged_filtered.sam \ OUTPUT=out/FilterBam.bam samtools view out/FilterBam.bam > out/FilterBam.sam @@ -47,7 +30,7 @@ diff out/FilterBam.sam ref/FilterBam.sam echo -e "\e[92m\e[1mPassed\e[0m" echo -echo -e "\e[93m\e[1mTest 4\e[0m" +echo -e "\e[93m\e[1mTest 2\e[0m" drop-seq TrimStartingSequence INPUT=out/FilterBam.bam OUTPUT=out/TrimStartingSequence.bam \ OUTPUT_SUMMARY=out/TrimStartingSequence.summary.txt SEQUENCE=AAGCAGTGGTATCAACGCAGAGTGAATGGG MISMATCHES=0 NUM_BASES=5 samtools view out/TrimStartingSequence.bam > out/TrimStartingSequence.sam @@ -55,7 +38,7 @@ diff out/TrimStartingSequence.sam ref/TrimStartingSequence.sam echo -e "\e[92m\e[1mPassed\e[0m" echo -echo -e "\e[93m\e[1mTest 5\e[0m" +echo -e "\e[93m\e[1mTest 3\e[0m" drop-seq PolyATrimmer INPUT=out/TrimStartingSequence.bam OUTPUT=out/PolyATrimmer.bam \ OUTPUT_SUMMARY=out/PolyATrimmer.summary.bam MISMATCHES=0 NUM_BASES=6 USE_NEW_TRIMMER=true samtools view out/PolyATrimmer.bam > out/PolyATrimmer.sam View it on GitLab: https://salsa.debian.org/med-team/htsjdk/-/compare/80d13b32682bcff805d8acbf5b86add4677c9491...5532e2d62b6fed55df6d713bf1d753624bc8344c -- View it on GitLab: https://salsa.debian.org/med-team/htsjdk/-/compare/80d13b32682bcff805d8acbf5b86add4677c9491...5532e2d62b6fed55df6d713bf1d753624bc8344c You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/htsjdk] Pushed new tag debian/4.1.0+dfsg-2
Pierre Gruet pushed new tag debian/4.1.0+dfsg-2 at Debian Med / htsjdk -- View it on GitLab: https://salsa.debian.org/med-team/htsjdk/-/tree/debian/4.1.0+dfsg-2 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
Re: [PATCH v15 00/16] Add audio support in v4l2 framework
On 5/9/24 06:13, Jaroslav Kysela wrote: > On 09. 05. 24 12:44, Shengjiu Wang wrote: mem2mem is just like the decoder in the compress pipeline. which is one of the components in the pipeline. >>> >>> I was thinking of loopback with endpoints using compress streams, >>> without physical endpoint, something like: >>> >>> compress playback (to feed data from userspace) -> DSP (processing) -> >>> compress capture (send data back to userspace) >>> >>> Unless I'm missing something, you should be able to process data as fast >>> as you can feed it and consume it in such case. >>> >> >> Actually in the beginning I tried this, but it did not work well. >> ALSA needs time control for playback and capture, playback and capture >> needs to synchronize. Usually the playback and capture pipeline is >> independent in ALSA design, but in this case, the playback and capture >> should synchronize, they are not independent. > > The core compress API core no strict timing constraints. You can > eventually0 have two half-duplex compress devices, if you like to have > really independent mechanism. If something is missing in API, you can > extend this API (like to inform the user space that it's a > producer/consumer processing without any relation to the real time). I > like this idea. The compress API was never intended to be used this way. It was meant to send compressed data to a DSP for rendering, and keep the host processor in a low-power state while the DSP local buffer was drained. There was no intent to do a loop back to the host, because that keeps the host in a high-power state and probably negates the power savings due to a DSP. The other problem with the loopback is that the compress stuff is usually a "Front-End" in ASoC/DPCM parlance, and we don't have a good way to do a loopback between Front-Ends. The entire framework is based on FEs being connected to BEs. One problem that I can see for ASRC is that it's not clear when the data will be completely processed on the "capture" stream when you stop the "playback" stream. There's a non-zero risk of having a truncated output or waiting for data that will never be generated. In other words, it might be possible to reuse/extend the compress API for a 'coprocessor' approach without any rendering to traditional interfaces, but it's uncharted territory.
[Git][java-team/sweethome3d][pristine-tar] pristine-tar data for sweethome3d_7.3+dfsg.orig.tar.xz
Pierre Gruet pushed to branch pristine-tar at Debian Java Maintainers / sweethome3d Commits: eba99aa3 by Pierre Gruet at 2024-05-14T22:30:46+02:00 pristine-tar data for sweethome3d_7.3+dfsg.orig.tar.xz - - - - - 2 changed files: - + sweethome3d_7.3+dfsg.orig.tar.xz.delta - + sweethome3d_7.3+dfsg.orig.tar.xz.id Changes: = sweethome3d_7.3+dfsg.orig.tar.xz.delta = Binary files /dev/null and b/sweethome3d_7.3+dfsg.orig.tar.xz.delta differ = sweethome3d_7.3+dfsg.orig.tar.xz.id = @@ -0,0 +1 @@ +e369b8369d7296f5d356da6585d33426503e2b96 View it on GitLab: https://salsa.debian.org/java-team/sweethome3d/-/commit/eba99aa38a8685a1ebe6718e0499c2f345e88990 -- View it on GitLab: https://salsa.debian.org/java-team/sweethome3d/-/commit/eba99aa38a8685a1ebe6718e0499c2f345e88990 You're receiving this email because of your account on salsa.debian.org. ___ pkg-java-commits mailing list pkg-java-comm...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/pkg-java-commits
[Git][java-team/sweethome3d][upstream] New upstream version 7.3+dfsg
Pierre Gruet pushed to branch upstream at Debian Java Maintainers / sweethome3d Commits: df7206fd by Pierre Gruet at 2024-05-14T22:30:31+02:00 New upstream version 7.3+dfsg - - - - - 30 changed files: - LICENSE.TXT - README.TXT - build.xml - deploy/SweetHome3DSplashScreen.jpg - install/macosx/10.4/Sweet Home 3D/Contents/Info.plist - install/macosx/Sweet Home 3D/Contents/Info.plist - install/portable/README.TXT - install/portable/SweetHome3D-linux-x64 - install/portable/SweetHome3D-linux-x86 - install/portable/SweetHome3D-windows-x64.xml - install/portable/SweetHome3D-windows-x86.xml - install/portable/SweetHome3D.cfg - install/viewer/README.TXT - install/windows/installerInnoSetup.iss - install/windows/installerLaunch4j-java3d-1.5.2-x64.xml - install/windows/installerLaunch4j-java3d-1.5.2-x86-d3d.xml - install/windows/installerLaunch4j-java3d-1.5.2-x86.xml - install/windows/installerLaunch4j-x64.xml - install/windows/installerLaunch4j-x86.xml - install/windows/signedInstallerInnoSetup.iss - src/com/eteks/sweethome3d/applet/package.properties - src/com/eteks/sweethome3d/io/DefaultFurnitureCatalog.properties - src/com/eteks/sweethome3d/io/DefaultTexturesCatalog.properties - src/com/eteks/sweethome3d/j3d/DimensionLine3D.java - src/com/eteks/sweethome3d/j3d/ModelManager.java - src/com/eteks/sweethome3d/model/HomeFurnitureGroup.java - src/com/eteks/sweethome3d/model/HomePieceOfFurniture.java - src/com/eteks/sweethome3d/package.properties - src/com/eteks/sweethome3d/plugin/PluginManager.java - src/com/eteks/sweethome3d/resources/splashScreen.jpg The diff was not included because it is too large. View it on GitLab: https://salsa.debian.org/java-team/sweethome3d/-/commit/df7206fd9d48ee2c0574c50a0484c2faa801d898 -- View it on GitLab: https://salsa.debian.org/java-team/sweethome3d/-/commit/df7206fd9d48ee2c0574c50a0484c2faa801d898 You're receiving this email because of your account on salsa.debian.org. ___ pkg-java-commits mailing list pkg-java-comm...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/pkg-java-commits
[Git][java-team/sweethome3d][master] 8 commits: New upstream version 7.3+dfsg
Pierre Gruet pushed to branch master at Debian Java Maintainers / sweethome3d Commits: df7206fd by Pierre Gruet at 2024-05-14T22:30:31+02:00 New upstream version 7.3+dfsg - - - - - 0b476c29 by Pierre Gruet at 2024-05-14T22:30:46+02:00 Update upstream source from tag upstream/7.3+dfsg Update to upstream version 7.3+dfsg with Debian dir 9b56100ed9bd38ea07c8a0a85cff44809b7732c3 - - - - - 274854bc by Pierre Gruet at 2024-05-14T22:31:58+02:00 Refreshing patches - - - - - e0927f5d by Pierre Gruet at 2024-05-14T22:32:43+02:00 Raising Standards version to 4.7.0 (no change) - - - - - 15384f76 by Pierre Gruet at 2024-05-14T22:37:35+02:00 Adding url and developer tag to the MetaInfo file - - - - - 4aa1b640 by Pierre Gruet at 2024-05-14T22:37:51+02:00 Using secure URI for homepage - - - - - 52d00c55 by Pierre Gruet at 2024-05-14T22:38:54+02:00 Updating changelog - - - - - ba55a095 by Pierre Gruet at 2024-05-14T22:39:05+02:00 Upload to unstable - - - - - 30 changed files: - LICENSE.TXT - README.TXT - build.xml - debian/changelog - debian/com.sweethome3d.sweethome3d.metainfo.xml - debian/control - debian/copyright - debian/patches/04manifest.patch - debian/patches/build.patch - debian/patches/no-video.patch - debian/patches/no_CalculatorFormat.patch - debian/patches/noadditionalprovisions.patch - deploy/SweetHome3DSplashScreen.jpg - install/macosx/10.4/Sweet Home 3D/Contents/Info.plist - install/macosx/Sweet Home 3D/Contents/Info.plist - install/portable/README.TXT - install/portable/SweetHome3D-linux-x64 - install/portable/SweetHome3D-linux-x86 - install/portable/SweetHome3D-windows-x64.xml - install/portable/SweetHome3D-windows-x86.xml - install/portable/SweetHome3D.cfg - install/viewer/README.TXT - install/windows/installerInnoSetup.iss - install/windows/installerLaunch4j-java3d-1.5.2-x64.xml - install/windows/installerLaunch4j-java3d-1.5.2-x86-d3d.xml - install/windows/installerLaunch4j-java3d-1.5.2-x86.xml - install/windows/installerLaunch4j-x64.xml - install/windows/installerLaunch4j-x86.xml - install/windows/signedInstallerInnoSetup.iss - src/com/eteks/sweethome3d/applet/package.properties The diff was not included because it is too large. View it on GitLab: https://salsa.debian.org/java-team/sweethome3d/-/compare/629c681411e8911f07206bdb70a068ae1e2efc11...ba55a0954d340d27bb5aca7e34df4a5fcdb0ed77 -- View it on GitLab: https://salsa.debian.org/java-team/sweethome3d/-/compare/629c681411e8911f07206bdb70a068ae1e2efc11...ba55a0954d340d27bb5aca7e34df4a5fcdb0ed77 You're receiving this email because of your account on salsa.debian.org. ___ pkg-java-commits mailing list pkg-java-comm...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/pkg-java-commits
[Git][java-team/sweethome3d] Pushed new tag upstream/7.3+dfsg
Pierre Gruet pushed new tag upstream/7.3+dfsg at Debian Java Maintainers / sweethome3d -- View it on GitLab: https://salsa.debian.org/java-team/sweethome3d/-/tree/upstream/7.3+dfsg You're receiving this email because of your account on salsa.debian.org. ___ pkg-java-commits mailing list pkg-java-comm...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/pkg-java-commits
[Git][java-team/sweethome3d] Pushed new tag debian/7.3+dfsg-1
Pierre Gruet pushed new tag debian/7.3+dfsg-1 at Debian Java Maintainers / sweethome3d -- View it on GitLab: https://salsa.debian.org/java-team/sweethome3d/-/tree/debian/7.3+dfsg-1 You're receiving this email because of your account on salsa.debian.org. ___ pkg-java-commits mailing list pkg-java-comm...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/pkg-java-commits
[RFR] po4a://manpages-fr/ptrace.2/po/fr/po
Bonjour, Ce fichier a été mis à jour. Merci d'avance pour vos relectures. Amicalement, jipege ptrace.2.po.tar.xz Description: application/xz-compressed-tar signature.asc Description: This is a digitally signed message part
[jira] [Updated] (NIFI-13238) Checkstyle - rules for whitespace
[ https://issues.apache.org/jira/browse/NIFI-13238?page=com.atlassian.jira.plugin.system.issuetabpanels:all-tabpanel ] Pierre Villard updated NIFI-13238: -- Status: Patch Available (was: Open) > Checkstyle - rules for whitespace > - > > Key: NIFI-13238 > URL: https://issues.apache.org/jira/browse/NIFI-13238 > Project: Apache NiFi > Issue Type: Improvement > Components: Tools and Build > Reporter: Pierre Villard >Assignee: Pierre Villard >Priority: Major > Time Spent: 10m > Remaining Estimate: 0h > > Adding the following rules: > * WhitespaceAfter > * NoWhitespaceAfter > * NoWhitespaceBefore > * WhitespaceAround -- This message was sent by Atlassian Jira (v8.20.10#820010)
[jira] [Created] (NIFI-13238) Checkstyle - rules for whitespace
Pierre Villard created NIFI-13238: - Summary: Checkstyle - rules for whitespace Key: NIFI-13238 URL: https://issues.apache.org/jira/browse/NIFI-13238 Project: Apache NiFi Issue Type: Improvement Components: Tools and Build Reporter: Pierre Villard Assignee: Pierre Villard Adding the following rules: * WhitespaceAfter * NoWhitespaceAfter * NoWhitespaceBefore * WhitespaceAround -- This message was sent by Atlassian Jira (v8.20.10#820010)
[jira] [Created] (NIFI-13237) Checkstyle improvements
Pierre Villard created NIFI-13237: - Summary: Checkstyle improvements Key: NIFI-13237 URL: https://issues.apache.org/jira/browse/NIFI-13237 Project: Apache NiFi Issue Type: Epic Reporter: Pierre Villard Assignee: Pierre Villard Epic to track the addition of some rules in the checkstyle configuration of the NiFi project. -- This message was sent by Atlassian Jira (v8.20.10#820010)
[med-svn] [Git][med-team/libgoby-java][master] 5 commits: Raising Standards version to 4.7.0 (no change)
Pierre Gruet pushed to branch master at Debian Med / libgoby-java Commits: e040d480 by Pierre Gruet at 2024-05-14T12:15:50+02:00 Raising Standards version to 4.7.0 (no change) - - - - - ac5646ec by Pierre Gruet at 2024-05-14T12:18:28+02:00 Restricting autopkgtest architecture to amd64 and arm64, where sra-sdk packages are installable - - - - - 00950edb by Pierre Gruet at 2024-05-14T12:19:25+02:00 Updating changelog - - - - - 596fcd7e by Pierre Gruet at 2024-05-14T12:22:06+02:00 Build-depending on pkgconf instead of obsolete pkg-config - - - - - 112f5f88 by Pierre Gruet at 2024-05-14T18:17:21+02:00 Upload to unstable - - - - - 3 changed files: - debian/changelog - debian/control - debian/tests/control Changes: = debian/changelog = @@ -1,3 +1,12 @@ +libgoby-java (3.3.1+dfsg2-11) unstable; urgency=medium + + * Raising Standards version to 4.7.0 (no change) + * Restricting autopkgtest architecture to amd64 and arm64, where sra-sdk +packages are installable + * Build-depending on pkgconf instead of obsolete pkg-config + + -- Pierre Gruet Tue, 14 May 2024 18:17:12 +0200 + libgoby-java (3.3.1+dfsg2-10) unstable; urgency=medium * Fixing the clean target (Closes: #1045612) = debian/control = @@ -39,13 +39,13 @@ Build-Depends-Indep: ant, libreflections-java, libpj-java, libprotobuf-dev, - pkg-config, + pkgconf, r-cran-rjava, libeasymock-java , junit4 , testng , libpicard-java -Standards-Version: 4.6.2 +Standards-Version: 4.7.0 Vcs-Browser: https://salsa.debian.org/med-team/libgoby-java/ Vcs-Git: https://salsa.debian.org/med-team/libgoby-java.git Homepage: https://campagnelab.org/software/goby/ = debian/tests/control = @@ -1,7 +1,9 @@ Tests: test-fasta-to-compact Depends: goby-java +Architecture: amd64 arm64 Restrictions: allow-stderr Tests: test-BZip2ChunkCodec Depends: libgoby-io-java, default-jdk +Architecture: amd64 arm64 Restrictions: allow-stderr View it on GitLab: https://salsa.debian.org/med-team/libgoby-java/-/compare/bbd317ed0d5bd421c5891ee907be160ff969c46f...112f5f88ffcb56a0f5c27a3cbea3fc67c727d15a -- View it on GitLab: https://salsa.debian.org/med-team/libgoby-java/-/compare/bbd317ed0d5bd421c5891ee907be160ff969c46f...112f5f88ffcb56a0f5c27a3cbea3fc67c727d15a You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/libgoby-java] Pushed new tag debian/3.3.1+dfsg2-11
Pierre Gruet pushed new tag debian/3.3.1+dfsg2-11 at Debian Med / libgoby-java -- View it on GitLab: https://salsa.debian.org/med-team/libgoby-java/-/tree/debian/3.3.1+dfsg2-11 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[RFR] po4a://manpages-fr/utimensat.2/po/fr/po
Bonjour, Ce fichier a été mis à jour. Merci d'avance pour vos relectures. Amicalement, jipege utimensat.2.po.tar.xz Description: application/xz-compressed-tar signature.asc Description: This is a digitally signed message part
[RFR] po4a://manpages-fr/time.2/po/fr/po
Bonjour, Ce fichier a été mis à jour. Merci d'avance pour vos relectures. Amicalement, jipege time.2.po.tar.xz Description: application/xz-compressed-tar signature.asc Description: This is a digitally signed message part
Re: New 2.3.8 Tarballs
Le 10/05/2024 à 10:51, Pavel Sanda a écrit : On Fri, May 10, 2024 at 10:38:01AM +0200, JP wrote: Sure, I will do it ASAP. Thanks. You should be able to commit any new files into wiki-uploads.git repository. Just create new directory in LyX/Manuals Completed, I added the Japanese manuals and left the Spanish ones as they are, users will see when opening them that they are still 2.3.X manuals. And the page reads "Released with 2.4.0", not "2.4.0 manuals". -- Jean-Pierre -- lyx-devel mailing list lyx-devel@lists.lyx.org http://lists.lyx.org/mailman/listinfo/lyx-devel
Re: TESTING Tarballs for 2.4.0
Le 13/05/2024 à 23:48, Richard Kimberly Heck a écrit : Hi, all, Tarballs for 2.4.0 are here: http://ftp.lyx.org/pub/lyx/devel/lyx-2.4/ Please test. Please let me know if I forgot to do or include anything. Compiles and works fine on Debian stable. -- Jean-Pierre -- lyx-devel mailing list lyx-devel@lists.lyx.org http://lists.lyx.org/mailman/listinfo/lyx-devel
[RFR] wml://devel/wnpp/index.wml
Bonjour, Ce fichier a été mis à jour. Merci d'avance pour vos relectures. Amicalement, jipege index.wml.tar.xz Description: application/xz-compressed-tar signature.asc Description: This is a digitally signed message part
[clang] [llvm] [AMDGPU] Add amdgpu-as MMRA for fences (PR #78572)
@@ -678,6 +680,54 @@ class SIMemoryLegalizer final : public MachineFunctionPass
{
bool runOnMachineFunction(MachineFunction ) override;
};
+static std::array, 3> ASNames = {{
+{"global", SIAtomicAddrSpace::GLOBAL},
+{"local", SIAtomicAddrSpace::LDS},
+{"image", SIAtomicAddrSpace::SCRATCH},
+}};
+
+void diagnoseUnknownMMRAASName(const MachineInstr , StringRef AS) {
+ const MachineFunction *MF = MI.getMF();
+ const Function = MF->getFunction();
+ std::string Str;
+ raw_string_ostream OS(Str);
+ OS << "unknown address space '" << AS << "'; expected one of ";
+ ListSeparator LS;
+ for (const auto &[Name, Val] : ASNames)
+OS << LS << '\'' << Name << '\'';
+ DiagnosticInfoUnsupported BadTag(Fn, Str, MI.getDebugLoc(), DS_Warning);
+ Fn.getContext().diagnose(BadTag);
+}
+
+/// Reads \p MI's MMRAs to parse the "amdgpu-as" MMRA.
+/// If this tag isn't present, or if it has no meaningful values, returns \p
+/// Default. Otherwise returns all the address spaces concerned by the MMRA.
+static SIAtomicAddrSpace getFenceAddrSpaceMMRA(const MachineInstr ,
+ SIAtomicAddrSpace Default) {
+ static constexpr StringLiteral FenceASPrefix = "amdgpu-as";
+
+ auto MMRA = MMRAMetadata(MI.getMMRAMetadata());
+ if (!MMRA)
+return Default;
+
+ SIAtomicAddrSpace Result = SIAtomicAddrSpace::NONE;
+ for (const auto &[Prefix, Suffix] : MMRA) {
+ if (Prefix != FenceASPrefix)
+ continue;
+
+auto It = find_if(ASNames, [Suffix = Suffix](auto ) {
Pierre-vh wrote:
Lambdas can't capture structured bindings (`auto [a, b] = pair`) in C++17, I
think it comes in C++20 or 23?
https://github.com/llvm/llvm-project/pull/78572
___
cfe-commits mailing list
cfe-commits@lists.llvm.org
https://lists.llvm.org/cgi-bin/mailman/listinfo/cfe-commits
Bug#1048703: plm: Fails to build source after successful build
Source: plm
Version: 2.9.2-1
Followup-For: Bug #1048703
Control: tags -1 patch
Dear Maintainer,
The enclosed patch will allow you to solve this bug.
Cheers,
--
Pierre
diff -Nru plm-2.9.2/debian/rules plm-2.9.2/debian/rules
--- plm-2.9.2/debian/rules 2020-10-11 21:54:58.0 +0200
+++ plm-2.9.2/debian/rules 2024-05-13 22:03:35.0 +0200
@@ -26,11 +26,28 @@
%:
dh $@ --with javahelper
+execute_before_dh_auto_configure:
+ # Making backups of files that will be altered during the build
+ for F in $$(find l10n/engine -name "*.po" -o -name "*.pot")
lib/resources/plm.configuration.properties; do \
+ cp $$F $${F}.save ;\
+ done
+
override_dh_auto_clean:
dh_auto_clean
find . -type f -name \*.java.json-simple \
-exec sh -c 'file={} && mv $$file $${file%.json-simple}' \; -print
+override_dh_clean:
+ dh_clean
+ # Removing files left there by the build system.
+ find . -name "*.jar" -delete
+ -rm dist/*.tar.bz2
+ -rm errors-*.txt
+ # Restoring files that were altered during the build
+ for F in $$(find . -name "*.save") ; do \
+ mv $$F $${F%.save} ;\
+ done
+
override_dh_auto_build:
find . -type f -name \*.java -exec grep -q 'import
@JSON_SIMPLE_PACKAGE@' {} \; \
-exec sed -i.json-simple \
Bug#1071082: FTBFS against jgit/6.7.0-1 in unstable
Source: plm
Version: 2.9.2-1
Severity: serious
Tags: ftbfs patch
Dear Maintainer,
I have just uploaded jgit/6.7.0 to unstable, in order to fix a security issue.
However, plm fails to build against it because some -- previously -- deprecated
methods have been removed.
The enclosed patch will allow you to build plm again.
Best,
--
Pierre
diff -Nru plm-2.9.2/debian/control plm-2.9.2/debian/control
--- plm-2.9.2/debian/control2020-10-11 21:54:58.0 +0200
+++ plm-2.9.2/debian/control2024-05-03 16:00:26.0 +0200
@@ -4,7 +4,7 @@
Maintainer: Martin Quinson
Build-Depends: debhelper-compat (= 12), javahelper (>= 0.32), ant, quilt
Build-Depends-Indep: default-jdk, scala, libmiglayout-java,
librsyntaxtextarea-java,
- junit4, libgettext-commons-java, libjson-simple-java, libhttpclient-java,
libhttpmime-java, libjgit-java,
+ junit4, libgettext-commons-java, libjson-simple-java, libhttpclient-java,
libhttpmime-java, libjgit-java (>= 6.7.0),
jython, libgettext-ant-tasks-java, imagemagick,
libmockito-java
Standards-Version: 4.5.0
diff -Nru plm-2.9.2/debian/patches/jgit_6.7.0.patch
plm-2.9.2/debian/patches/jgit_6.7.0.patch
--- plm-2.9.2/debian/patches/jgit_6.7.0.patch 1970-01-01 01:00:00.0
+0100
+++ plm-2.9.2/debian/patches/jgit_6.7.0.patch 2024-05-03 16:00:26.0
+0200
@@ -0,0 +1,26 @@
+Description: replacing methods removed in jgit 6.7.0
+ The method getRef in Repository had been deprecated in previous versions, and
+ is now removed.
+Author: Pierre Gruet
+Forwarded: no
+Last-Update: 2024-05-03
+
+--- a/src/plm/core/model/tracking/GitUtils.java
b/src/plm/core/model/tracking/GitUtils.java
+@@ -126,7 +126,7 @@
+
+ public void mergeRemoteIntoLocalBranch(String userBranchHash) throws
Exception {
+ try {
+- MergeResult res =
git.merge().setCommit(true).setFastForward(MergeCommand.FastForwardMode.FF).setStrategy(MergeStrategy.RECURSIVE).include(git.getRepository().getRef("refs/remotes/origin/"+userBranchHash)).call();
++ MergeResult res =
git.merge().setCommit(true).setFastForward(MergeCommand.FastForwardMode.FF).setStrategy(MergeStrategy.RECURSIVE).include(git.getRepository().findRef("refs/remotes/origin/"+userBranchHash)).call();
+
+ if(res.getMergeStatus() ==
MergeResult.MergeStatus.FAST_FORWARD) {
+ System.out.println(Game.i18n.tr("last session
data successfully retrieved"));
+@@ -376,6 +376,6 @@
+ }
+
+ public Ref getRepoRef(String branch) throws IOException {
+- return git.getRepository().getRef(branch);
++ return git.getRepository().findRef(branch);
+ }
+ }
diff -Nru plm-2.9.2/debian/patches/series plm-2.9.2/debian/patches/series
--- plm-2.9.2/debian/patches/series 2020-10-11 21:54:58.0 +0200
+++ plm-2.9.2/debian/patches/series 2024-05-03 15:59:24.0 +0200
@@ -4,3 +4,4 @@
jython-fixes
json-simple-3.patch
+jgit_6.7.0.patch
Bug#1071082: FTBFS against jgit/6.7.0-1 in unstable
Source: plm
Version: 2.9.2-1
Severity: serious
Tags: ftbfs patch
Dear Maintainer,
I have just uploaded jgit/6.7.0 to unstable, in order to fix a security issue.
However, plm fails to build against it because some -- previously -- deprecated
methods have been removed.
The enclosed patch will allow you to build plm again.
Best,
--
Pierre
diff -Nru plm-2.9.2/debian/control plm-2.9.2/debian/control
--- plm-2.9.2/debian/control2020-10-11 21:54:58.0 +0200
+++ plm-2.9.2/debian/control2024-05-03 16:00:26.0 +0200
@@ -4,7 +4,7 @@
Maintainer: Martin Quinson
Build-Depends: debhelper-compat (= 12), javahelper (>= 0.32), ant, quilt
Build-Depends-Indep: default-jdk, scala, libmiglayout-java,
librsyntaxtextarea-java,
- junit4, libgettext-commons-java, libjson-simple-java, libhttpclient-java,
libhttpmime-java, libjgit-java,
+ junit4, libgettext-commons-java, libjson-simple-java, libhttpclient-java,
libhttpmime-java, libjgit-java (>= 6.7.0),
jython, libgettext-ant-tasks-java, imagemagick,
libmockito-java
Standards-Version: 4.5.0
diff -Nru plm-2.9.2/debian/patches/jgit_6.7.0.patch
plm-2.9.2/debian/patches/jgit_6.7.0.patch
--- plm-2.9.2/debian/patches/jgit_6.7.0.patch 1970-01-01 01:00:00.0
+0100
+++ plm-2.9.2/debian/patches/jgit_6.7.0.patch 2024-05-03 16:00:26.0
+0200
@@ -0,0 +1,26 @@
+Description: replacing methods removed in jgit 6.7.0
+ The method getRef in Repository had been deprecated in previous versions, and
+ is now removed.
+Author: Pierre Gruet
+Forwarded: no
+Last-Update: 2024-05-03
+
+--- a/src/plm/core/model/tracking/GitUtils.java
b/src/plm/core/model/tracking/GitUtils.java
+@@ -126,7 +126,7 @@
+
+ public void mergeRemoteIntoLocalBranch(String userBranchHash) throws
Exception {
+ try {
+- MergeResult res =
git.merge().setCommit(true).setFastForward(MergeCommand.FastForwardMode.FF).setStrategy(MergeStrategy.RECURSIVE).include(git.getRepository().getRef("refs/remotes/origin/"+userBranchHash)).call();
++ MergeResult res =
git.merge().setCommit(true).setFastForward(MergeCommand.FastForwardMode.FF).setStrategy(MergeStrategy.RECURSIVE).include(git.getRepository().findRef("refs/remotes/origin/"+userBranchHash)).call();
+
+ if(res.getMergeStatus() ==
MergeResult.MergeStatus.FAST_FORWARD) {
+ System.out.println(Game.i18n.tr("last session
data successfully retrieved"));
+@@ -376,6 +376,6 @@
+ }
+
+ public Ref getRepoRef(String branch) throws IOException {
+- return git.getRepository().getRef(branch);
++ return git.getRepository().findRef(branch);
+ }
+ }
diff -Nru plm-2.9.2/debian/patches/series plm-2.9.2/debian/patches/series
--- plm-2.9.2/debian/patches/series 2020-10-11 21:54:58.0 +0200
+++ plm-2.9.2/debian/patches/series 2024-05-03 15:59:24.0 +0200
@@ -4,3 +4,4 @@
jython-fixes
json-simple-3.patch
+jgit_6.7.0.patch
[Git][java-team/eclipse-jgit][pristine-tar] pristine-tar data for jgit_6.7.0.orig.tar.xz
Pierre Gruet pushed to branch pristine-tar at Debian Java Maintainers / eclipse-jgit Commits: ac499ee1 by Pierre Gruet at 2024-04-23T14:05:14+02:00 pristine-tar data for jgit_6.7.0.orig.tar.xz - - - - - 2 changed files: - + jgit_6.7.0.orig.tar.xz.delta - + jgit_6.7.0.orig.tar.xz.id Changes: = jgit_6.7.0.orig.tar.xz.delta = Binary files /dev/null and b/jgit_6.7.0.orig.tar.xz.delta differ = jgit_6.7.0.orig.tar.xz.id = @@ -0,0 +1 @@ +89a9c6cb9b56c10b9236e8af222ed31bde466e16 View it on GitLab: https://salsa.debian.org/java-team/eclipse-jgit/-/commit/ac499ee11b3c01c5546fc8aed7cc594c7db163ef -- View it on GitLab: https://salsa.debian.org/java-team/eclipse-jgit/-/commit/ac499ee11b3c01c5546fc8aed7cc594c7db163ef You're receiving this email because of your account on salsa.debian.org. ___ pkg-java-commits mailing list pkg-java-comm...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/pkg-java-commits
[Git][java-team/eclipse-jgit][upstream] New upstream version 6.7.0
Pierre Gruet pushed to branch upstream at Debian Java Maintainers / eclipse-jgit Commits: bbc1c714 by Pierre Gruet at 2024-04-23T14:05:03+02:00 New upstream version 6.7.0 - - - - - 30 changed files: - + .bazelrc - + .bazelversion - .gitignore - .mailmap - .mvn/maven.config - + .settings/org.eclipse.core.resources.prefs - BUILD - + CODE_OF_CONDUCT.md - CONTRIBUTING.md - + Documentation/config-options.md - Documentation/technical/reftable.md - README.md - + SECURITY.md - WORKSPACE - lib/BUILD - + lib/jmh/BUILD - org.eclipse.jgit.ant.test/.classpath - org.eclipse.jgit.ant.test/.settings/org.eclipse.jdt.core.prefs - org.eclipse.jgit.ant.test/.settings/org.eclipse.jdt.ui.prefs - org.eclipse.jgit.ant.test/.settings/org.eclipse.mylyn.team.ui.prefs - + org.eclipse.jgit.ant.test/.settings/org.eclipse.pde.prefs - org.eclipse.jgit.ant.test/META-INF/MANIFEST.MF - org.eclipse.jgit.ant.test/build.properties - org.eclipse.jgit.ant.test/plugin.properties - org.eclipse.jgit.ant.test/pom.xml - org.eclipse.jgit.ant.test/src/org/eclipse/jgit/ant/tasks/GitCloneTaskTest.java - org.eclipse.jgit.ant/.classpath - org.eclipse.jgit.ant/.settings/org.eclipse.jdt.core.prefs - org.eclipse.jgit.ant/.settings/org.eclipse.jdt.ui.prefs - org.eclipse.jgit.ant/.settings/org.eclipse.mylyn.team.ui.prefs The diff was not included because it is too large. View it on GitLab: https://salsa.debian.org/java-team/eclipse-jgit/-/commit/bbc1c714ea67bb038bced115e1f1b44c954154f2 -- View it on GitLab: https://salsa.debian.org/java-team/eclipse-jgit/-/commit/bbc1c714ea67bb038bced115e1f1b44c954154f2 You're receiving this email because of your account on salsa.debian.org. ___ pkg-java-commits mailing list pkg-java-comm...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/pkg-java-commits
[Git][java-team/eclipse-jgit][master] 13 commits: New upstream version 6.7.0
Pierre Gruet pushed to branch master at Debian Java Maintainers / eclipse-jgit Commits: bbc1c714 by Pierre Gruet at 2024-04-23T14:05:03+02:00 New upstream version 6.7.0 - - - - - 1fa34c94 by Pierre Gruet at 2024-04-23T14:05:14+02:00 Update upstream source from tag upstream/6.7.0 Update to upstream version 6.7.0 with Debian dir 1da28fdb695a82f184e164c48c633ea9e261228f - - - - - b25643d8 by Pierre Gruet at 2024-04-23T14:09:02+02:00 Refreshing patches - - - - - a55177f4 by Pierre Gruet at 2024-04-23T14:09:20+02:00 Raising Standards version to 4.7.0 (no change) - - - - - 6076d4d6 by Pierre Gruet at 2024-04-23T14:13:32+02:00 Updating changelog - - - - - 4504b660 by Pierre Gruet at 2024-05-13T22:29:55+02:00 Updating build-dependencies and Maven rules - - - - - 65a267c3 by Pierre Gruet at 2024-05-13T22:30:18+02:00 Updating the list of pom.xml files to ignore - - - - - 7cb535d0 by Pierre Gruet at 2024-05-13T22:30:51+02:00 Building the package with javac instead of the eclipse compiler - - - - - 73e5742c by Pierre Gruet at 2024-05-13T22:31:26+02:00 Setting the versions of the Debian-packaged Maven plugins for the build - - - - - 2fb26bbd by Pierre Gruet at 2024-05-13T22:31:53+02:00 Skipping the generation of unneeded artifacts with maven-antrun-plugin - - - - - 267bc9b3 by Pierre Gruet at 2024-05-13T22:32:39+02:00 Updating changelog - - - - - b64207b1 by Pierre Gruet at 2024-05-13T20:33:31+00:00 Trim trailing whitespace. Changes-By: lintian-brush Fixes: lintian: trailing-whitespace See-also: https://lintian.debian.org/tags/trailing-whitespace.html - - - - - 3ea9154e by Pierre Gruet at 2024-05-13T22:35:56+02:00 Upload to unstable - - - - - 30 changed files: - + .bazelrc - + .bazelversion - .gitignore - .mailmap - .mvn/maven.config - + .settings/org.eclipse.core.resources.prefs - BUILD - + CODE_OF_CONDUCT.md - CONTRIBUTING.md - + Documentation/config-options.md - Documentation/technical/reftable.md - README.md - + SECURITY.md - WORKSPACE - debian/changelog - debian/control - debian/libjgit-java.poms - debian/maven.ignoreRules - debian/maven.rules - + debian/patches/build_with_javac.patch - − debian/patches/disable-errorprone.patch - + debian/patches/no_create_jgit.patch - + debian/patches/plugins_versions.patch - debian/patches/series - debian/patches/unversioned-orbit-dependencies.patch - lib/BUILD - + lib/jmh/BUILD - org.eclipse.jgit.ant.test/.classpath - org.eclipse.jgit.ant.test/.settings/org.eclipse.jdt.core.prefs - org.eclipse.jgit.ant.test/.settings/org.eclipse.jdt.ui.prefs The diff was not included because it is too large. View it on GitLab: https://salsa.debian.org/java-team/eclipse-jgit/-/compare/345772ff33c2685cf16c17f65d34cd8f93f256d1...3ea9154e79e1fb52021ac7d3a677e2f74c331923 -- View it on GitLab: https://salsa.debian.org/java-team/eclipse-jgit/-/compare/345772ff33c2685cf16c17f65d34cd8f93f256d1...3ea9154e79e1fb52021ac7d3a677e2f74c331923 You're receiving this email because of your account on salsa.debian.org. ___ pkg-java-commits mailing list pkg-java-comm...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/pkg-java-commits
[Git][java-team/eclipse-jgit] Pushed new tag debian/6.7.0-1
Pierre Gruet pushed new tag debian/6.7.0-1 at Debian Java Maintainers / eclipse-jgit -- View it on GitLab: https://salsa.debian.org/java-team/eclipse-jgit/-/tree/debian/6.7.0-1 You're receiving this email because of your account on salsa.debian.org. ___ pkg-java-commits mailing list pkg-java-comm...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/pkg-java-commits
[Git][java-team/eclipse-jgit] Pushed new tag upstream/6.7.0
Pierre Gruet pushed new tag upstream/6.7.0 at Debian Java Maintainers / eclipse-jgit -- View it on GitLab: https://salsa.debian.org/java-team/eclipse-jgit/-/tree/upstream/6.7.0 You're receiving this email because of your account on salsa.debian.org. ___ pkg-java-commits mailing list pkg-java-comm...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/pkg-java-commits
[Git][java-team/libmina-sshd-java][master] Upload to unstable
Pierre Gruet pushed to branch master at Debian Java Maintainers / libmina-sshd-java Commits: 3ec193d0 by Pierre Gruet at 2024-05-13T20:11:18+02:00 Upload to unstable - - - - - 1 changed file: - debian/changelog Changes: = debian/changelog = @@ -1,3 +1,9 @@ +libmina-sshd-java (2.12.1-2) unstable; urgency=medium + + * Source-only upload to unstable + + -- Pierre Gruet Mon, 13 May 2024 20:10:58 +0200 + libmina-sshd-java (2.12.1-1) experimental; urgency=medium * Initial release (Closes: #683639) View it on GitLab: https://salsa.debian.org/java-team/libmina-sshd-java/-/commit/3ec193d06f788db1ff9ef5e2cb89ca7118e91be5 -- View it on GitLab: https://salsa.debian.org/java-team/libmina-sshd-java/-/commit/3ec193d06f788db1ff9ef5e2cb89ca7118e91be5 You're receiving this email because of your account on salsa.debian.org. ___ pkg-java-commits mailing list pkg-java-comm...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/pkg-java-commits
[Git][java-team/libmina-sshd-java] Pushed new tag debian/2.12.1-2
Pierre Gruet pushed new tag debian/2.12.1-2 at Debian Java Maintainers / libmina-sshd-java -- View it on GitLab: https://salsa.debian.org/java-team/libmina-sshd-java/-/tree/debian/2.12.1-2 You're receiving this email because of your account on salsa.debian.org. ___ pkg-java-commits mailing list pkg-java-comm...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/pkg-java-commits
[clang] [llvm] [AMDGPU] Add amdgpu-as MMRA for fences (PR #78572)
@@ -4408,6 +4409,42 @@ Target-Specific Extensions Clang supports some language features conditionally on some targets. +AMDGPU Language Extensions +-- + +__builtin_amdgcn_fence +^^ + +``__builtin_amdgcn_fence`` emits a fence. + +* ``unsigned`` atomic ordering, e.g. ``__ATOMIC_ACQUIRE`` +* ``const char *`` synchronization scope, e.g. ``workgroup`` +* Zero or more ``const char *`` address spaces names. + +The address spaces arguments must be string literals with known values, such as: + +* ``"local"`` +* ``"global"`` +* ``"image"`` + +If one or more address space name are provided, the code generator will attempt +to emit potentially faster instructions that only fence those address spaces. +Emitting such instructions may not always be possible and the compiler is free +to fence more aggressively. + +If no address spaces names are provided, all address spaces are fenced. + +.. code-block:: c++ + + // Fence all address spaces. + __builtin_amdgcn_fence(__ATOMIC_SEQ_CST, "workgroup"); + __builtin_amdgcn_fence(__ATOMIC_ACQUIRE, "agent"); + + // Fence only requested address spaces. + __builtin_amdgcn_fence(__ATOMIC_SEQ_CST, "workgroup", "local") Pierre-vh wrote: This is just for internal use right now, so we can use anything we want. Device libs can then map the IMAGE flag to a "private" operand here. https://github.com/llvm/llvm-project/pull/78572 ___ cfe-commits mailing list cfe-commits@lists.llvm.org https://lists.llvm.org/cgi-bin/mailman/listinfo/cfe-commits
Bug#1014539: squirrel3: CVE-2022-30292
Hello,
Matthias Geiger wrote on 07/05/2024 at 00:05:36+0200:
> On Thu, 18 Apr 2024 14:40:58 +0200 Matthias Geiger
> wrote:
>
>>
>> //I have prepared a fix; however this needs the FTBFS in #997441
>> adressed first.
>>
>> Will attach a debdiff once that has happened.
>>
>
> See attachement.
>
> best,
I've uploaded this debdiff in DELAYED/7.
Please reach out if there's any issue.
Bests,
--
PEB
diff -Nru squirrel3-3.1/debian/changelog squirrel3-3.1/debian/changelog
--- squirrel3-3.1/debian/changelog 2024-04-29 23:39:09.0 +0200
+++ squirrel3-3.1/debian/changelog 2024-05-13 14:59:34.0 +0200
@@ -1,3 +1,11 @@
+squirrel3 (3.1-8.2) unstable; urgency=medium
+
+ * Non-maintainer upload.
+ * Cherry-pick upstream commit as 03-fix-buffer-overflow.diff
+Closes: #1014539, CVE-2022-30292
+
+ -- Matthias Geiger Mon, 13 May 2024 14:59:34 +0200
+
squirrel3 (3.1-8.1) unstable; urgency=medium
* Non-maintainer upload.
diff -Nru squirrel3-3.1/debian/patches/03-fix-buffer-overflow.diff squirrel3-3.1/debian/patches/03-fix-buffer-overflow.diff
--- squirrel3-3.1/debian/patches/03-fix-buffer-overflow.diff 1970-01-01 01:00:00.0 +0100
+++ squirrel3-3.1/debian/patches/03-fix-buffer-overflow.diff 2024-05-13 14:59:20.0 +0200
@@ -0,0 +1,22 @@
+From a6413aa690e0bdfef648c68693349a7b878fe60d Mon Sep 17 00:00:00 2001
+From: Alberto Demichelis
+Date: Mon, 2 May 2022 12:04:58 +0200
+Subject: [PATCH] fix in thread.call
+
+---
+ squirrel/sqbaselib.cpp | 1 +
+ 1 file changed, 1 insertion(+)
+
+diff --git a/squirrel/sqbaselib.cpp b/squirrel/sqbaselib.cpp
+index 662aeac..e283900 100644
+--- a/squirrel/sqbaselib.cpp
b/squirrel/sqbaselib.cpp
+@@ -1012,6 +1012,7 @@ static SQInteger thread_call(HSQUIRRELVM v)
+ SQObjectPtr o = stack_get(v,1);
+ if(type(o) == OT_THREAD) {
+ SQInteger nparams = sq_gettop(v);
++sq_reservestack(_thread(o), nparams + 3);
+ _thread(o)->Push(_thread(o)->_roottable);
+ for(SQInteger i = 2; i<(nparams+1); i++)
+ sq_move(_thread(o),v,i);
+
diff -Nru squirrel3-3.1/debian/patches/series squirrel3-3.1/debian/patches/series
--- squirrel3-3.1/debian/patches/series 2024-04-29 23:33:43.0 +0200
+++ squirrel3-3.1/debian/patches/series 2024-05-13 14:59:20.0 +0200
@@ -1,2 +1,3 @@
01-fix-spelling-errors.patch
02-sphinx-ext.patch
+03-fix-buffer-overflow.diff
signature.asc
Description: PGP signature
Bug#1014539: squirrel3: CVE-2022-30292
Hello,
Matthias Geiger wrote on 07/05/2024 at 00:05:36+0200:
> On Thu, 18 Apr 2024 14:40:58 +0200 Matthias Geiger
> wrote:
>
>>
>> //I have prepared a fix; however this needs the FTBFS in #997441
>> adressed first.
>>
>> Will attach a debdiff once that has happened.
>>
>
> See attachement.
>
> best,
I've uploaded this debdiff in DELAYED/7.
Please reach out if there's any issue.
Bests,
--
PEB
diff -Nru squirrel3-3.1/debian/changelog squirrel3-3.1/debian/changelog
--- squirrel3-3.1/debian/changelog 2024-04-29 23:39:09.0 +0200
+++ squirrel3-3.1/debian/changelog 2024-05-13 14:59:34.0 +0200
@@ -1,3 +1,11 @@
+squirrel3 (3.1-8.2) unstable; urgency=medium
+
+ * Non-maintainer upload.
+ * Cherry-pick upstream commit as 03-fix-buffer-overflow.diff
+Closes: #1014539, CVE-2022-30292
+
+ -- Matthias Geiger Mon, 13 May 2024 14:59:34 +0200
+
squirrel3 (3.1-8.1) unstable; urgency=medium
* Non-maintainer upload.
diff -Nru squirrel3-3.1/debian/patches/03-fix-buffer-overflow.diff squirrel3-3.1/debian/patches/03-fix-buffer-overflow.diff
--- squirrel3-3.1/debian/patches/03-fix-buffer-overflow.diff 1970-01-01 01:00:00.0 +0100
+++ squirrel3-3.1/debian/patches/03-fix-buffer-overflow.diff 2024-05-13 14:59:20.0 +0200
@@ -0,0 +1,22 @@
+From a6413aa690e0bdfef648c68693349a7b878fe60d Mon Sep 17 00:00:00 2001
+From: Alberto Demichelis
+Date: Mon, 2 May 2022 12:04:58 +0200
+Subject: [PATCH] fix in thread.call
+
+---
+ squirrel/sqbaselib.cpp | 1 +
+ 1 file changed, 1 insertion(+)
+
+diff --git a/squirrel/sqbaselib.cpp b/squirrel/sqbaselib.cpp
+index 662aeac..e283900 100644
+--- a/squirrel/sqbaselib.cpp
b/squirrel/sqbaselib.cpp
+@@ -1012,6 +1012,7 @@ static SQInteger thread_call(HSQUIRRELVM v)
+ SQObjectPtr o = stack_get(v,1);
+ if(type(o) == OT_THREAD) {
+ SQInteger nparams = sq_gettop(v);
++sq_reservestack(_thread(o), nparams + 3);
+ _thread(o)->Push(_thread(o)->_roottable);
+ for(SQInteger i = 2; i<(nparams+1); i++)
+ sq_move(_thread(o),v,i);
+
diff -Nru squirrel3-3.1/debian/patches/series squirrel3-3.1/debian/patches/series
--- squirrel3-3.1/debian/patches/series 2024-04-29 23:33:43.0 +0200
+++ squirrel3-3.1/debian/patches/series 2024-05-13 14:59:20.0 +0200
@@ -1,2 +1,3 @@
01-fix-spelling-errors.patch
02-sphinx-ext.patch
+03-fix-buffer-overflow.diff
signature.asc
Description: PGP signature
Re: https://projects.apache.org/statistics.html
That is indeed a pity. IMO, regular and consistent provision of statistical insights (BI, comes to mind) supporting the statements in the quarterly project report would help would help the reader of a o assess a project's health beyond the statements found there. If the foundation can provide insights in its annual report (see e.g. page 19-22 of https://apache.org/foundation/docs/FY2023AnnualReport.pdf), it should be able to provide similar insights per project on a quarterly basis. But having such provision to be dependent on an individual volunteer (or on a 3rd party without commitment) is a risk. Often far greater than initially hoped for. As for the underlying technologies: the ASF has access to that with products like Apache Superset, Apache Arrow and various data storage solutions. Met vriendelijke groet, Pierre On Wed, Apr 17, 2024 at 11:27 PM sebb wrote: > It seems snoot.io has been abandoned. > > I'll remove the references. > > [1] https://lists.apache.org/thread/hv11bmodqhzhoqxq8ky72trtmwogc18q > > On Wed, 17 Apr 2024 at 10:26, sebb wrote: > > > > The page relies on the 3rd party provider snoot.io. > > > > This appears to have gone away; the hostname no longer resolves. > > > > On Wed, 17 Apr 2024 at 08:00, Pierre Smits > wrote: > > > > > > Hi all, > > > > > > it seems that https://projects.apache.org/statistics.html doesn't work > > > anymore as it does not show any statistics > > > > > > Met vriendelijke groet, > > > > > > Pierre > > - > To unsubscribe, e-mail: dev-unsubscr...@community.apache.org > For additional commands, e-mail: dev-h...@community.apache.org > >
[jira] [Updated] (OFBIZ-12951) CommonExt - Move from hard-code menu location to parameterized
[ https://issues.apache.org/jira/browse/OFBIZ-12951?page=com.atlassian.jira.plugin.system.issuetabpanels:all-tabpanel ] Pierre Smits updated OFBIZ-12951: - Attachment: Screenshot 2024-05-13 at 12.18.38.png > CommonExt - Move from hard-code menu location to parameterized > -- > > Key: OFBIZ-12951 > URL: https://issues.apache.org/jira/browse/OFBIZ-12951 > Project: OFBiz > Issue Type: Sub-task > Components: commonext >Affects Versions: Upcoming Branch >Reporter: Pierre Smits >Assignee: Jacques Le Roux >Priority: Major > Fix For: Upcoming Branch > > Attachments: Screenshot 2024-05-05 at 20.32.11.png, Screenshot > 2024-05-13 at 12.18.38.png > > > Move the menu location in the various commonest screens from hard-coded to > parameterized. -- This message was sent by Atlassian Jira (v8.20.10#820010)
[jira] [Commented] (OFBIZ-12951) CommonExt - Move from hard-code menu location to parameterized
[ https://issues.apache.org/jira/browse/OFBIZ-12951?page=com.atlassian.jira.plugin.system.issuetabpanels:comment-tabpanel=17845870#comment-17845870 ] Pierre Smits commented on OFBIZ-12951: -- Hi Jacques, Yes, I did. And I am still investigating. If you could merge PR#795, it would surely help (see attached image), as switching between trunk and dev/test branches in the local dev environment is cumbersome and a potential source of confusion. > CommonExt - Move from hard-code menu location to parameterized > -- > > Key: OFBIZ-12951 > URL: https://issues.apache.org/jira/browse/OFBIZ-12951 > Project: OFBiz > Issue Type: Sub-task > Components: commonext >Affects Versions: Upcoming Branch >Reporter: Pierre Smits >Assignee: Jacques Le Roux >Priority: Major > Fix For: Upcoming Branch > > Attachments: Screenshot 2024-05-05 at 20.32.11.png > > > Move the menu location in the various commonest screens from hard-coded to > parameterized. -- This message was sent by Atlassian Jira (v8.20.10#820010)
[jira] [Commented] (OFBIZ-13015) Miss UI user message for projectmgr/control/MyTimesheet
[
https://issues.apache.org/jira/browse/OFBIZ-13015?page=com.atlassian.jira.plugin.system.issuetabpanels:comment-tabpanel=17845867#comment-17845867
]
Pierre Smits commented on OFBIZ-13015:
--
Hi Jacques,
Unfortunately, Adrian. is not around anymore to ask him. At times I feel him
dearly missed as a source of insights and a voice of reason.
Yes, I know bit was implemented 17 years ago. I suggest to log in to any
application with a userLogId that is not one of the *ADMIN' and doesn't have
ASSETMAINT permissions.
E.g. in Manufacturing, when updating a Routing or Task or ProductionRun this
becomes obvious. See attached image.
Furthermore, it has been agreed long ago that there should be no dependencies
of ofbiz-framework application on ofbiz-plugin components.
> Miss UI user message for projectmgr/control/MyTimesheet
> ---
>
> Key: OFBIZ-13015
> URL: https://issues.apache.org/jira/browse/OFBIZ-13015
> Project: OFBiz
> Issue Type: Improvement
> Components: projectmgr
>Affects Versions: Upcoming Branch
>Reporter: Jacques Le Roux
>Priority: Minor
> Fix For: Upcoming Branch
>
> Attachments: Screenshot 2024-05-13 at 11.59.32.png
>
>
> Currently there is only a hard legible message for users without sufficient
> permissions (sorry in French):
> ERROR MESSAGE
> java.lang.IllegalArgumentException: Error running script at location
> [component://projectmgr/src/main/groovy/org/apache/ofbiz/projectmgr/EditWeekTimesheet.groovy]:
> org.apache.ofbiz.service.ExecutionServiceException: ERROR: Could not
> complete the Create Timesheet For This Week of no date provided, otherwise
> for a specific week [TimesheetServices.xml#createTimesheetForThisWeek]
> process [problem invoking the [createTimesheet] service with the map named
> [parameters] containing
> [{userLogin=[GenericEntity:UserLogin][createdStamp,2024-04-12
> 02:36:48.635(java.sql.Timestamp)][createdTxStamp,2024-04-12
> 02:36:48.551(java.sql.Timestamp)][currentPassword,{SHA}47b56994cbc2b6d10aa1be30f70165adb305a41a(java.lang.String)][disabledBy,null()][disabledDateTime,null()][enabled,null()][externalAuthId,null()][hasLoggedOut,null()][isSystem,null()][lastCurrencyUom,null()][lastLocale,null()][lastTimeZone,null()][lastUpdatedStamp,2024-04-12
> 02:36:48.635(java.sql.Timestamp)][lastUpdatedTxStamp,2024-04-12
> 02:36:48.551(java.sql.Timestamp)][partyId,DemoAuditor(java.lang.String)][passwordHint,null()][requirePasswordChange,null()][successiveFailedLogins,null()][userLdapDn,null()][userLoginId,auditor(java.lang.String)],
> fromDate=2024-04-07 00:00:00.0,
> timeZone=sun.util.calendar.ZoneInfo[id="Etc/UTC",offset=0,dstSavings=0,useDaylight=false,transitions=0,lastRule=null],
> partyId=DemoAuditor, locale=fr, thruDate=2024-04-13 23:59:59.0}]: Vous
> n'avez pas la permission sur le service createTimesheet, raison : Erreur de
> sécurité : pour exécuter createTimesheet vous devez avoir une des
> autorisations suivantes : ASSETMAINT_CREATE, ASSETMAINT_ADMIN]
> Even if I think users can understand the meaning, it's not very clean
--
This message was sent by Atlassian Jira
(v8.20.10#820010)
[jira] [Updated] (OFBIZ-13015) Miss UI user message for projectmgr/control/MyTimesheet
[
https://issues.apache.org/jira/browse/OFBIZ-13015?page=com.atlassian.jira.plugin.system.issuetabpanels:all-tabpanel
]
Pierre Smits updated OFBIZ-13015:
-
Attachment: Screenshot 2024-05-13 at 11.59.32.png
> Miss UI user message for projectmgr/control/MyTimesheet
> ---
>
> Key: OFBIZ-13015
> URL: https://issues.apache.org/jira/browse/OFBIZ-13015
> Project: OFBiz
> Issue Type: Improvement
> Components: projectmgr
>Affects Versions: Upcoming Branch
>Reporter: Jacques Le Roux
>Priority: Minor
> Fix For: Upcoming Branch
>
> Attachments: Screenshot 2024-05-13 at 11.59.32.png
>
>
> Currently there is only a hard legible message for users without sufficient
> permissions (sorry in French):
> ERROR MESSAGE
> java.lang.IllegalArgumentException: Error running script at location
> [component://projectmgr/src/main/groovy/org/apache/ofbiz/projectmgr/EditWeekTimesheet.groovy]:
> org.apache.ofbiz.service.ExecutionServiceException: ERROR: Could not
> complete the Create Timesheet For This Week of no date provided, otherwise
> for a specific week [TimesheetServices.xml#createTimesheetForThisWeek]
> process [problem invoking the [createTimesheet] service with the map named
> [parameters] containing
> [{userLogin=[GenericEntity:UserLogin][createdStamp,2024-04-12
> 02:36:48.635(java.sql.Timestamp)][createdTxStamp,2024-04-12
> 02:36:48.551(java.sql.Timestamp)][currentPassword,{SHA}47b56994cbc2b6d10aa1be30f70165adb305a41a(java.lang.String)][disabledBy,null()][disabledDateTime,null()][enabled,null()][externalAuthId,null()][hasLoggedOut,null()][isSystem,null()][lastCurrencyUom,null()][lastLocale,null()][lastTimeZone,null()][lastUpdatedStamp,2024-04-12
> 02:36:48.635(java.sql.Timestamp)][lastUpdatedTxStamp,2024-04-12
> 02:36:48.551(java.sql.Timestamp)][partyId,DemoAuditor(java.lang.String)][passwordHint,null()][requirePasswordChange,null()][successiveFailedLogins,null()][userLdapDn,null()][userLoginId,auditor(java.lang.String)],
> fromDate=2024-04-07 00:00:00.0,
> timeZone=sun.util.calendar.ZoneInfo[id="Etc/UTC",offset=0,dstSavings=0,useDaylight=false,transitions=0,lastRule=null],
> partyId=DemoAuditor, locale=fr, thruDate=2024-04-13 23:59:59.0}]: Vous
> n'avez pas la permission sur le service createTimesheet, raison : Erreur de
> sécurité : pour exécuter createTimesheet vous devez avoir une des
> autorisations suivantes : ASSETMAINT_CREATE, ASSETMAINT_ADMIN]
> Even if I think users can understand the meaning, it's not very clean
--
This message was sent by Atlassian Jira
(v8.20.10#820010)
Re: Ne supprimer que les liens symboliques
Bonjour,
Le find est tout à fait correct mis-à-part qu’il manquerait l’indication de la
racine. Si tu veux être certain duplique le répertoire racine avec un :
# rsync -Aavx MonRep/ MonRep-Sauve/
Du coup tu peux lancer ton find sans risques :
# find -P MonRep -type l -exec /bin/rm -f {} \;
Si tout est bon tu peux supprimer la sauvegarde :
# \rm -Rf MonRep-Sauve
Bonne journée
> Le 13 mai 2024 à 10:14, benoit a écrit :
>
>
> Bonjour,
>
> Pour mon usage perso, j’ai écrit un petit script qui crée des liens
> symbolique vers des fichiers dans un répertoire donné.
>
> Mais j’aimerais que ce script me propose de supprimer les liens symboliques
> déjà existants dans ce répertoire.
>
>
>
> rm -f *
> ou
> unlik
>
> Ca risque de supprimer des fichiers qui se trouveraient là or je ne veux
> supprimer que des liens symboliques et surtout pas les fichiers pointé ni des
> fichier ordinaires.
>
> Je ne comprends pas pourquoi unlik malgré son nom, supprime tous les fichiers
> et pas uniquement les liens symboliques.
>
> Suis-je obligé de passer par find ?
>
>
> find -P -type l -exec rm {} \;
>
> -P ne JAMAIS suivre un lien symbolique
>
> -type l ne trouver que des liens symboliques
>
> C’est correct ?
>
> Quelles sont les autres options ?
>
>
>
> Merci d'avance
>
>
>
> --
>
> Benoît
>
>
--
Pierre Malard
Responsable architectures système CDS DINAMIS/THEIA Montpellier
IRD - UMR Espace-Dev - UAR CPST - IR Data-Terra
Maison de la Télédétection
500 rue Jean-François Breton
34093 Montpellier Cx 5
France
Tél : +33 626 89 22 68
« Il faut créer en même temps les élites et les débouchés, le syndica-
lisme et les usines. Faire l'un sans l'autre, c'est travailler pour le
malheur du peuple. »
Romain Gary - "Les racines du ciel"
|\ _,,,---,,_
/,`.-'`'-. ;-;;,_
|,4- ) )-,_. ,\ ( `'-'
'---''(_/--' `-'\_) πr
perl -e '$_=q#: 3|\ 5_,3-3,2_: 3/,`.'"'"'`'"'"' 5-. ;-;;,_: |,A- ) )-,_. ,\
( `'"'"'-'"'"': '"'"'-3'"'"'2(_/--'"'"' `-'"'"'\_):
24πr::#;y#:#\n#;s#(\D)(\d+)#$1x$2#ge;print'
- --> Ce message n’engage que son auteur <--
signature.asc
Description: Message signed with OpenPGP
[jira] [Created] (OFBIZ-13090) Manufacturing - VIEW permissions
Pierre Smits created OFBIZ-13090: Summary: Manufacturing - VIEW permissions Key: OFBIZ-13090 URL: https://issues.apache.org/jira/browse/OFBIZ-13090 Project: OFBiz Issue Type: Improvement Components: manufacturing Reporter: Pierre Smits Currently, a user with only 'VIEW' permissions, as demonstrated in trunk demo with userId = auditor, accessing a ProductionRun related screen, sees triggers (to requests) reserved for users with 'CREATE' or 'UPDATE' permissions. To see/test: https://localhost:8443/manufacturing/control/ShowProductionRun -- This message was sent by Atlassian Jira (v8.20.10#820010)
[clang] [llvm] [AMDGPU] Add amdgpu-as MMRA for fences (PR #78572)
@@ -4408,6 +4409,42 @@ Target-Specific Extensions Clang supports some language features conditionally on some targets. +AMDGPU Language Extensions +-- + +__builtin_amdgcn_fence +^^ + +``__builtin_amdgcn_fence`` emits a fence. + +* ``unsigned`` atomic ordering, e.g. ``__ATOMIC_ACQUIRE`` +* ``const char *`` synchronization scope, e.g. ``workgroup`` +* Zero or more ``const char *`` address spaces names. + +The address spaces arguments must be string literals with known values, such as: + +* ``"local"`` +* ``"global"`` +* ``"image"`` + +If one or more address space name are provided, the code generator will attempt +to emit potentially faster instructions that only fence those address spaces. +Emitting such instructions may not always be possible and the compiler is free +to fence more aggressively. + +If no address spaces names are provided, all address spaces are fenced. + +.. code-block:: c++ + + // Fence all address spaces. + __builtin_amdgcn_fence(__ATOMIC_SEQ_CST, "workgroup"); + __builtin_amdgcn_fence(__ATOMIC_ACQUIRE, "agent"); + + // Fence only requested address spaces. + __builtin_amdgcn_fence(__ATOMIC_SEQ_CST, "workgroup", "local") Pierre-vh wrote: I wasusing the OpenCL terminology: https://registry.khronos.org/OpenCL/sdk/3.0/docs/man/html/atomic_work_item_fence.html > flags must be set to CLK_GLOBAL_MEM_FENCE, CLK_LOCAL_MEM_FENCE, > CLK_IMAGE_MEM_FENCE Thinking about it, maybe it's better to use names consistent with our AMDGPUAS definitions, so image would just be "private" but local/global stay. What do you think? https://github.com/llvm/llvm-project/pull/78572 ___ cfe-commits mailing list cfe-commits@lists.llvm.org https://lists.llvm.org/cgi-bin/mailman/listinfo/cfe-commits
[clang] [llvm] [AMDGPU] Add amdgpu-as MMRA for fences (PR #78572)
@@ -18365,6 +18366,28 @@ Value *CodeGenFunction::EmitHLSLBuiltinExpr(unsigned
BuiltinID,
return nullptr;
}
+void CodeGenFunction::AddAMDGCNFenceAddressSpaceMMRA(llvm::Instruction *Inst,
+ const CallExpr *E) {
+ constexpr const char *Tag = "amdgpu-as";
--------
Pierre-vh wrote:
I think it's just more readable this way, but I have no strong preference
either.
I'd say let's keep it this way, it can very easily be renamed later if we want
to.
https://github.com/llvm/llvm-project/pull/78572
___
cfe-commits mailing list
cfe-commits@lists.llvm.org
https://lists.llvm.org/cgi-bin/mailman/listinfo/cfe-commits
[jira] [Commented] (OFBIZ-13049) Configurable Main page
[
https://issues.apache.org/jira/browse/OFBIZ-13049?page=com.atlassian.jira.plugin.system.issuetabpanels:comment-tabpanel=17845810#comment-17845810
]
Pierre Smits commented on OFBIZ-13049:
--
{quote}Perhaps you it would help us understand your position if you provide
some non-portlet examples of how OFBiz uses data to dynamically to affect the
user experience.
{quote}
I suggest when logging in at any application in
[https://demo-trunk.ofbiz.apache.org/] to use a userLoginId other than one
associated with the admin party.
In every place where the condition 'hasPermission' is used users have a data
driven experience.
> Configurable Main page
> --
>
> Key: OFBIZ-13049
> URL: https://issues.apache.org/jira/browse/OFBIZ-13049
> Project: OFBiz
> Issue Type: Improvement
> Components: ALL APPLICATIONS
> Reporter: Pierre Smits
>Priority: Major
> Attachments: CommonPortletData.xml
>
>
> Currently the OFBiz product has configurable Main pages in applications
> Accounting, Order, SFA, and plugin MyPortal. Unfortunately, none in the
> community felt the urge to implement the concept further in other
> applications.
> Having a configurable Main page of an application improves both the appeal of
> OFBiz to (potential) adopters and their users, and to developers.
> With a configurable Main page, developers have less screens to consider when
> doing customisation, while at the same time trying to stay in sync with
> changes from the project.
--
This message was sent by Atlassian Jira
(v8.20.10#820010)
Re: How can you end up with a discrepancy between branchmap and heads?
Just to quick reply to point that some extension tweak these commands. For example, topic hide draft changeset with topic to client without topic (but still allow a pull with an explicit hash). Topic is probably not involved here because these changeset are public, but that's an exemple of things that might happens. I am just back from two week of pto, and I won't have time to have a deeper look to this right now, but please ping me again next week if I forgot to get back to you by then. On 5/4/24 23:10, Mike Hommey wrote: Hi, I'm trying to reproduce a peculiarity of the (former) pypy mercurial repository (https://foss.heptapod.net/pypy/pypy) but I can't manage to reproduce locally, even if I stream-clone the original repository (with hg --config experimental.evolution=true clone --stream $url). So, what's peculiar about the repository is that the following changesets aren't listed in its heads (https://foss.heptapod.net/pypy/pypy?cmd=heads): 96b962f458200a4757ea4a5ddf00b0ef73f267a5 dd73cf12b2d2d1b0c8420fe5d64b3a372db20a29 9787f52124b1bf6086b1286bb16fcbd2cca4ed80 d5ab4175e409e094208483118daa5a7bffd37141 2eb83a0fb3e9c1b5712aea9d767c3a775b3aaf85 but they appear in the branchmap (https://foss.heptapod.net/pypy/pypy?cmd=branchmap). If you clone the repository, you don't end up with them locally, but if you hg pull -r $sha1, you can get them. So far, I've ruled out obsolescence markers and phases being a possible source. I'm trying to generate a minimal reproducer to write a testcase for git-cinnabar. I guess, worst case scenario, I could change the listed heads via an extension? But I'm also curious what's up with the original repository. Bad cache? I know of other cases where that can happen, namely, when the head of a named branch is merged into another branch and is thus not a topological head. But that's not the case here. Mike ___ Mercurial-devel mailing list Mercurial-devel@lists.mercurial-scm.org https://lists.mercurial-scm.org/mailman/listinfo/mercurial-devel -- Pierre-Yves David ___ Mercurial-devel mailing list Mercurial-devel@lists.mercurial-scm.org https://lists.mercurial-scm.org/mailman/listinfo/mercurial-devel
[jira] [Updated] (OFBIZ-13088) CATALOG-Main: VIEW permission
[ https://issues.apache.org/jira/browse/OFBIZ-13088?page=com.atlassian.jira.plugin.system.issuetabpanels:all-tabpanel ] Pierre Smits updated OFBIZ-13088: - Summary: CATALOG-Main: VIEW permission (was: CATALOG-Main) > CATALOG-Main: VIEW permission > - > > Key: OFBIZ-13088 > URL: https://issues.apache.org/jira/browse/OFBIZ-13088 > Project: OFBiz > Issue Type: Improvement > Components: product/catalog > Reporter: Pierre Smits >Priority: Major > Labels: usability > > Currently, a user with only 'VIEW' permissions, as demonstrated in trunk demo > with userId = auditor, accessing the Catalog Main Page, sees triggers (to > requests) reserved for users with 'CREATE' or 'UPDATE' permissions. > To see/test: https://demo-trunk.ofbiz.apache.org/catalog/control/main -- This message was sent by Atlassian Jira (v8.20.10#820010)
[jira] [Created] (OFBIZ-13088) CATALOG-Main
Pierre Smits created OFBIZ-13088: Summary: CATALOG-Main Key: OFBIZ-13088 URL: https://issues.apache.org/jira/browse/OFBIZ-13088 Project: OFBiz Issue Type: Improvement Components: product/catalog Reporter: Pierre Smits Currently, a user with only 'VIEW' permissions, as demonstrated in trunk demo with userId = auditor, accessing the Catalog Main Page, sees triggers (to requests) reserved for users with 'CREATE' or 'UPDATE' permissions. To see/test: https://demo-trunk.ofbiz.apache.org/catalog/control/main -- This message was sent by Atlassian Jira (v8.20.10#820010)
[jira] [Commented] (OFBIZ-13049) Configurable Main page
[ https://issues.apache.org/jira/browse/OFBIZ-13049?page=com.atlassian.jira.plugin.system.issuetabpanels:comment-tabpanel=17845790#comment-17845790 ] Pierre Smits commented on OFBIZ-13049: -- Hi [~danwatford], Yes, SMART is an acronym. See:[https://en.wikipedia.org/wiki/SMART_criteria] > Configurable Main page > -- > > Key: OFBIZ-13049 > URL: https://issues.apache.org/jira/browse/OFBIZ-13049 > Project: OFBiz > Issue Type: Improvement > Components: ALL APPLICATIONS > Reporter: Pierre Smits >Priority: Major > Attachments: CommonPortletData.xml > > > Currently the OFBiz product has configurable Main pages in applications > Accounting, Order, SFA, and plugin MyPortal. Unfortunately, none in the > community felt the urge to implement the concept further in other > applications. > Having a configurable Main page of an application improves both the appeal of > OFBiz to (potential) adopters and their users, and to developers. > With a configurable Main page, developers have less screens to consider when > doing customisation, while at the same time trying to stay in sync with > changes from the project. -- This message was sent by Atlassian Jira (v8.20.10#820010)
[ceph-users] Re: ceph dashboard reef 18.2.2 radosgw
Hi Christopher, I think your issue may be fixed by https://github.com/ceph/ceph/pull/54764, which should be included in the next Reef release. In the meantime, you should be able to update your RGW configuration to include port=80. You will need to restart every RGW daemon so that all the metadata is updated. Best wishes, Pierre Riteau On Wed, 8 May 2024 at 19:51, Christopher Durham wrote: > Hello, > I am uisng 18.2.2 on Rocky 8 Linux. > > I am getting http error 500 whe trying to hit the ceph dashboard on reef > 18.2.2 when trying to look at any of the radosgw pages. > I tracked this down to /usr/share/ceph/mgr/dashboard/controllers/rgw.py > It appears to parse the metadata for a given radosgw server improperly. In > my varoous rgw ceph.conf entries, I have: > rgw frontends = beast ssl_endpoint=0.0.0.0 > ssl_certificate=/path/to/pem_with_cert_and_key > but, rgw.py pulls the metadata for each server, and it is looking for > 'port=' in the metadata for each server. When it doesn't find it based on > line 147 in rgw.py, the ceph-mgr logs throwan exception which the manager > proper catches and returns a 500. > Would changing my frontends definition work? Is this known? I have had the > frontends definition for awhile prior to my reef upgrade. Thanks > -Chris > ___ > ceph-users mailing list -- ceph-users@ceph.io > To unsubscribe send an email to ceph-users-le...@ceph.io > ___ ceph-users mailing list -- ceph-users@ceph.io To unsubscribe send an email to ceph-users-le...@ceph.io
[Git][java-team/libfastutil-java][master] 3 commits: Fixing clean rule to keep package-info.java files
Pierre Gruet pushed to branch master at Debian Java Maintainers / libfastutil-java Commits: 6ef1b49d by Pierre Gruet at 2024-05-12T21:06:39+02:00 Fixing clean rule to keep package-info.java files - - - - - f9f86881 by Pierre Gruet at 2024-05-12T21:06:52+02:00 Raising Standards version to 4.7.0 - - - - - e425b0cf by Pierre Gruet at 2024-05-12T21:09:52+02:00 Upload to unstable - - - - - 3 changed files: - debian/changelog - debian/control - debian/rules Changes: = debian/changelog = @@ -1,8 +1,9 @@ -libfastutil-java (8.5.12+dfsg-2) UNRELEASED; urgency=medium +libfastutil-java (8.5.12+dfsg-2) unstable; urgency=medium * Fixing the clean target (Closes: #1048315) + * Raising Standards version to 4.7.0 (no change) - -- Pierre Gruet Mon, 14 Aug 2023 23:38:23 +0200 + -- Pierre Gruet Sun, 12 May 2024 21:09:31 +0200 libfastutil-java (8.5.12+dfsg-1) unstable; urgency=medium = debian/control = @@ -13,7 +13,7 @@ Build-Depends: debhelper-compat (= 13), junit4 , libhamcrest-java , maven-repo-helper -Standards-Version: 4.6.2 +Standards-Version: 4.7.0 Rules-Requires-Root: no Vcs-Browser: https://salsa.debian.org/java-team/libfastutil-java Vcs-Git: https://salsa.debian.org/java-team/libfastutil-java.git = debian/rules = @@ -20,6 +20,7 @@ override_dh_clean: # Attention: This # find src/it/unimi/dsi/fastutil -mindepth 2 -name "*.java" -delete # does not work because files in /io need to remain + # Also package-info.java files need to remain find \ src/it/unimi/dsi/fastutil/booleans \ src/it/unimi/dsi/fastutil/bytes \ @@ -30,7 +31,7 @@ override_dh_clean: src/it/unimi/dsi/fastutil/longs \ src/it/unimi/dsi/fastutil/objects \ src/it/unimi/dsi/fastutil/shorts \ - -name "*.java" -delete + -name "*.java" -a ! -name "package-info.java" -delete rm -f src/it/unimi/dsi/fastutil/io/BinIO.java src/it/unimi/dsi/fastutil/io/TextIO.java # Removing test reports rm -rf reports View it on GitLab: https://salsa.debian.org/java-team/libfastutil-java/-/compare/6f99f239f7eeff7f5fba3cc9a96a1bbc91644316...e425b0cf5b46678ac065a32f65067731aca37b4f -- View it on GitLab: https://salsa.debian.org/java-team/libfastutil-java/-/compare/6f99f239f7eeff7f5fba3cc9a96a1bbc91644316...e425b0cf5b46678ac065a32f65067731aca37b4f You're receiving this email because of your account on salsa.debian.org. ___ pkg-java-commits mailing list pkg-java-comm...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/pkg-java-commits
[Git][java-team/libfastutil-java] Pushed new tag debian/8.5.12+dfsg-2
Pierre Gruet pushed new tag debian/8.5.12+dfsg-2 at Debian Java Maintainers / libfastutil-java -- View it on GitLab: https://salsa.debian.org/java-team/libfastutil-java/-/tree/debian/8.5.12+dfsg-2 You're receiving this email because of your account on salsa.debian.org. ___ pkg-java-commits mailing list pkg-java-comm...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/pkg-java-commits
[med-svn] [Git][med-team/snpeff][pristine-tar] pristine-tar data for snpeff_5.2.b+dfsg.orig.tar.xz
Pierre Gruet pushed to branch pristine-tar at Debian Med / snpeff Commits: 8653546b by Pierre Gruet at 2024-05-12T21:16:04+02:00 pristine-tar data for snpeff_5.2.b+dfsg.orig.tar.xz - - - - - 2 changed files: - + snpeff_5.2.b+dfsg.orig.tar.xz.delta - + snpeff_5.2.b+dfsg.orig.tar.xz.id Changes: = snpeff_5.2.b+dfsg.orig.tar.xz.delta = Binary files /dev/null and b/snpeff_5.2.b+dfsg.orig.tar.xz.delta differ = snpeff_5.2.b+dfsg.orig.tar.xz.id = @@ -0,0 +1 @@ +0597321160c2d9edbf98cc54819796d5b99bfa63 View it on GitLab: https://salsa.debian.org/med-team/snpeff/-/commit/8653546be151f66c9a10c3896d9346d30ef07fa8 -- View it on GitLab: https://salsa.debian.org/med-team/snpeff/-/commit/8653546be151f66c9a10c3896d9346d30ef07fa8 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/snpeff][upstream] Import Upstream version 5.2.b+dfsg
Pierre Gruet pushed to branch upstream at Debian Med / snpeff Commits: 42370782 by Pierre Gruet at 2024-05-12T21:14:28+02:00 Import Upstream version 5.2.b+dfsg - - - - - 30 changed files: - .vscode/launch.json - + config/snpEff.ENSEMBL_110.config - + config/snpEff.ENSEMBL_BFMPP_57.config - + config/snpEff.bundles.ENSEMBL_BFMPP_57.config - config/snpEff.config - config/snpEff.dbs.config - config/snpEff.test.config - docs/download/index.html - + docs/images/coverage_hitogram.png - docs/index.html - docs/sitemap.xml.gz - docs/snpeff/faq/index.html - docs/snpeff/inputoutput/index.html - docs/snpeff/outputsummary/index.html - docs/versions.txt - galaxy/tool-data/snpEff_genomes.loc - galaxy/tool-data/snpEff_genomes.loc.sample - − pcingola_cleanup.xml - − pcingola_formatter.xml - src/bds/download/downloadEnsemblBulk.bds - src/bds/download/downloadGenome.bds - src/bds/download/downloadMane.bds - src/bds/make.bds - src/docs/download.md - + src/docs/images/coverage_hitogram.png - src/docs/index.md - src/docs/snpeff/faq.md - src/docs/snpeff/inputoutput.md - src/docs/snpeff/outputsummary.md - src/main/java/org/snpeff/SnpEff.java The diff was not included because it is too large. View it on GitLab: https://salsa.debian.org/med-team/snpeff/-/commit/4237078237a3adf6ebc45297563660676d020a86 -- View it on GitLab: https://salsa.debian.org/med-team/snpeff/-/commit/4237078237a3adf6ebc45297563660676d020a86 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/snpeff][master] 2 commits: Import Upstream version 5.2.b+dfsg
Pierre Gruet pushed to branch master at Debian Med / snpeff Commits: 42370782 by Pierre Gruet at 2024-05-12T21:14:28+02:00 Import Upstream version 5.2.b+dfsg - - - - - 50acaa15 by Andreas Tille at 2024-05-12T21:14:30+02:00 Import Debian changes 5.2.b+dfsg-1 snpeff (5.2.b+dfsg-1) unstable; urgency=medium . [ Pierre Gruet ] * New upstream version * Refreshing patches * Changing the path to tests in the autopkgtest * Alleviating d/rules and correcting paths in the patches as build-time test .java files are now conveniently located under src/test * Removing now unused Lintian override . [ Andreas Tille ] * Remove trailing whitespace in debian/copyright (routine-update) * Lintian-override for all source-is-missing issues * d/watch: fix download name - - - - - 30 changed files: - .vscode/launch.json - + config/snpEff.ENSEMBL_110.config - + config/snpEff.ENSEMBL_BFMPP_57.config - + config/snpEff.bundles.ENSEMBL_BFMPP_57.config - config/snpEff.config - config/snpEff.dbs.config - config/snpEff.test.config - debian/changelog - debian/patches/update_launching_script_and_config_file_for_Debian.patch - debian/source/lintian-overrides - debian/watch - docs/download/index.html - + docs/images/coverage_hitogram.png - docs/index.html - docs/sitemap.xml.gz - docs/snpeff/faq/index.html - docs/snpeff/inputoutput/index.html - docs/snpeff/outputsummary/index.html - docs/versions.txt - galaxy/tool-data/snpEff_genomes.loc - galaxy/tool-data/snpEff_genomes.loc.sample - − pcingola_cleanup.xml - − pcingola_formatter.xml - src/bds/download/downloadEnsemblBulk.bds - src/bds/download/downloadGenome.bds - src/bds/download/downloadMane.bds - src/bds/make.bds - src/docs/download.md - + src/docs/images/coverage_hitogram.png - src/docs/index.md The diff was not included because it is too large. View it on GitLab: https://salsa.debian.org/med-team/snpeff/-/compare/7db0d55baee06c00358acacdb7cd864cba604c33...50acaa15c4ab990f51f8e1cc4f31bdf99aebddbf -- View it on GitLab: https://salsa.debian.org/med-team/snpeff/-/compare/7db0d55baee06c00358acacdb7cd864cba604c33...50acaa15c4ab990f51f8e1cc4f31bdf99aebddbf You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/snpeff] Pushed new tag upstream/5.2.b+dfsg
Pierre Gruet pushed new tag upstream/5.2.b+dfsg at Debian Med / snpeff -- View it on GitLab: https://salsa.debian.org/med-team/snpeff/-/tree/upstream/5.2.b+dfsg You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/snpeff] Pushed new tag debian/5.2.b+dfsg-1
Pierre Gruet pushed new tag debian/5.2.b+dfsg-1 at Debian Med / snpeff -- View it on GitLab: https://salsa.debian.org/med-team/snpeff/-/tree/debian/5.2.b+dfsg-1 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
Re: Probléme de clés et dépôts Debian
Bonjour, As-tu essayé de nettoyer la bibliothèque et les caches APT ? Cel force APT à reconstituer sa base. # \rm -Rf /var/lib/apt* /var/cache/apt* Recréer la racine « aptitude : # mkdir /var/lib/aptitude et relancer une mise à jour : # aptitude update > Le 12 mai 2024 à 12:52, Christophe Musseau a écrit : > > Bonjour la liste, > > Ces derniers temps pas mal de mise à jour, et notamment avec Testing. > Consécutivement à une de ces récentes mise à jour, quand je lance # > aptitude update, j'ai droit aux messages suivants. Cela ne m'empêche > pas d'effectuer les mises à jour, mais je ne comprends pas et n'arrive > pas à résoudre ce problème avec les clés. > > Messages : > W: > http://debug.mirrors.debian.org/debian-debug/dists/testing-debug/InRelease > : Unknown response from gpgv to --assert-pubkey-algo check: gpgv: > error: Error parsing command-line arguments > W: > http://security.debian.org/debian-security/dists/bookworm-security/InRelease > : Unknown response from gpgv to --assert-pubkey-algo check: gpgv: > error: Error parsing command-line arguments > W: https://dl.google.com/linux/chrome/deb/dists/stable/InRelease: > Unknown response from gpgv to --assert-pubkey-algo check: gpgv: > error: Error parsing command-line arguments > W: http://deb.debian.org/debian/dists/bookworm/InRelease: Unknown > response from gpgv to --assert-pubkey-algo check: gpgv: error: Error > parsing command-line arguments > W: http://deb.debian.org/debian/dists/bookworm-updates/InRelease: > Unknown response from gpgv to --assert-pubkey-algo check: gpgv: > error: Error parsing command-line arguments > W: http://deb.debian.org/debian/dists/testing/InRelease: Unknown > response from gpgv to --assert-pubkey-algo check: gpgv: error: Error > parsing command-line arguments > W: > http://deb.debian.org/debian-security/dists/testing-security/updates/InRelease > : Unknown response from gpgv to --assert-pubkey-algo check: gpgv: > error: Error parsing command-line arguments > W: http://deb.debian.org/debian/dists/testing-updates/InRelease: > Unknown response from gpgv to --assert-pubkey-algo check: gpgv: > error: Error parsing command-line arguments > > Si quelqu'un a une solution à me proposer. > Merci par avance > > Krystof26 > -- Pierre Malard Responsable architectures système CDS DINAMIS/THEIA Montpellier IRD - UMR Espace-Dev - UAR CPST - IR Data-Terra Maison de la Télédétection 500 rue Jean-François Breton 34093 Montpellier Cx 5 France Tél : +33 626 89 22 68 «Il vaut mieux passer à La Poste qu’à la postérité» Alphonse Allais |\ _,,,---,,_ /,`.-'`'-. ;-;;,_ |,4- ) )-,_. ,\ ( `'-' '---''(_/--' `-'\_) πr perl -e '$_=q#: 3|\ 5_,3-3,2_: 3/,`.'"'"'`'"'"' 5-. ;-;;,_: |,A- ) )-,_. ,\ ( `'"'"'-'"'"': '"'"'-3'"'"'2(_/--'"'"' `-'"'"'\_): 24πr::#;y#:#\n#;s#(\D)(\d+)#$1x$2#ge;print' - --> Ce message n’engage que son auteur <-- signature.asc Description: Message signed with OpenPGP
[Git][java-team/libeddsa-java][master] Upload to unstable
Pierre Gruet pushed to branch master at Debian Java Maintainers / libeddsa-java Commits: 4694f2c0 by Pierre Gruet at 2024-05-11T17:49:12+02:00 Upload to unstable - - - - - 1 changed file: - debian/changelog Changes: = debian/changelog = @@ -1,3 +1,9 @@ +libeddsa-java (0.3.0-2) unstable; urgency=medium + + * Source-only upload to unstable + + -- Pierre Gruet Sat, 11 May 2024 17:48:56 +0200 + libeddsa-java (0.3.0-1) experimental; urgency=medium * Initial release (Closes: #1069970) View it on GitLab: https://salsa.debian.org/java-team/libeddsa-java/-/commit/4694f2c089e935b7c0f53dcab488ba367e9f15ad -- View it on GitLab: https://salsa.debian.org/java-team/libeddsa-java/-/commit/4694f2c089e935b7c0f53dcab488ba367e9f15ad You're receiving this email because of your account on salsa.debian.org. ___ pkg-java-commits mailing list pkg-java-comm...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/pkg-java-commits
[Git][java-team/libeddsa-java] Pushed new tag debian/0.3.0-2
Pierre Gruet pushed new tag debian/0.3.0-2 at Debian Java Maintainers / libeddsa-java -- View it on GitLab: https://salsa.debian.org/java-team/libeddsa-java/-/tree/debian/0.3.0-2 You're receiving this email because of your account on salsa.debian.org. ___ pkg-java-commits mailing list pkg-java-comm...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/pkg-java-commits
Re: New 2.3.8 Tarballs
Le 10/05/2024 à 10:51, Pavel Sanda a écrit : On Fri, May 10, 2024 at 10:38:01AM +0200, JP wrote: Sure, I will do it ASAP. Thanks. You should be able to commit any new files into wiki-uploads.git repository. Just create new directory in LyX/Manuals So I cloned locally wiki-uploads and committed the manuals in a 2.4 directory. Two problems: - I do not see directory 2.4 there https://git.lyx.org/gitweb/?p=wiki-uploads.git;a=tree;f=LyX/Manuals;h=ff50f62b09e435ac1083bf149f4379245af74c02;hb=4fa520e50b8a16ac7eccfe0d8517399ffcaa467a but I see it perfectly from the wiki itself: https://wiki.lyx.org/uploads/LyX/Manuals/ - I updated the wiki password a month ago, but the new password does not seem to work properly. Can you remind it to me? -- Jean-Pierre -- lyx-devel mailing list lyx-devel@lists.lyx.org http://lists.lyx.org/mailman/listinfo/lyx-devel
[jira] [Commented] (OFBIZ-13049) Configurable Main page
[
https://issues.apache.org/jira/browse/OFBIZ-13049?page=com.atlassian.jira.plugin.system.issuetabpanels:comment-tabpanel=17845567#comment-17845567
]
Pierre Smits commented on OFBIZ-13049:
--
Hi Jacques,
Thank you for your reaction.
{quote}I re-read the comments above where Daniel and Michael were not
enthusiast.
{quote}
Regarding the feedback from Daniel, I repeat what I commented earlier:
{quote}I am just utilising what is available OOTB. implemented and reviewed by
quite a few contributors in the period between 2008 and 2010 (amongst other
Bruno Busco, David Jones and even you) under ticket OFBIZ-1999 and follow-ups.
{quote}
I am *not* introducing different technologies or concepts alien to what is
already available in the OFBiz. As for
{quote} Introducing another layer of indirection via the database will reduce
the navigability of the UI further.
{quote}
We use data everywhere to showcase the flexibility and usability of OFBiz. The
user experience (the appeal of OFBiz as an Open Source business management and
e-commerce solution) is dependent on data.
Similarly the customization appeal and experience is affected by hard coded
aspects. Everywhere we have that, we make it challenging for adopters to apply
and maintain their customizations without disrupting ongoing updates from the
OFBiz community. Having application main pages displaying what is most
important through PortalPortlet and associated records facilitate just that
flexibility and adaptability. I regard this ticket equally beneficial to
adopters and their developers as OFBIZ-12928.
{quote}Would you mind to assume this task before we continue with subtasks here?
{quote}
Thank you for the suggestion. I will keep it in mind for future consideration.
For now, I'm focused on prioritizing straightforward improvements that
significantly benefit both the user and developer experience.
Participating in an open source project is as much about enhancing the user and
developer experience through collaboration as it is about refining the
codebase. I truly value our positive collaborations I've had in this project
and look forward to more in the future.
This means that I don't just create new tickets for myself to work on; I also
do it to encourage fellow contributors to offer valuable feedback on the matter
at hand and to engage in the development process.
> Configurable Main page
> --
>
> Key: OFBIZ-13049
> URL: https://issues.apache.org/jira/browse/OFBIZ-13049
> Project: OFBiz
> Issue Type: Improvement
> Components: ALL APPLICATIONS
> Reporter: Pierre Smits
>Priority: Major
> Attachments: CommonPortletData.xml
>
>
> Currently the OFBiz product has configurable Main pages in applications
> Accounting, Order, SFA, and plugin MyPortal. Unfortunately, none in the
> community felt the urge to implement the concept further in other
> applications.
> Having a configurable Main page of an application improves both the appeal of
> OFBiz to (potential) adopters and their users, and to developers.
> With a configurable Main page, developers have less screens to consider when
> doing customisation, while at the same time trying to stay in sync with
> changes from the project.
--
This message was sent by Atlassian Jira
(v8.20.10#820010)
Re: [RFR] po4a://manpages-fr/systemd.1.po/fr.po
Bonjour, Le vendredi 10 mai 2024 à 15:26 +0200, bu...@no-log.org a écrit : > Bonjour, > Ce fichier (et d'autres) a évolué, > Voici une proposition de mise à jour, > il s'agit surtout de deux lignes qui se répercuteront sur d'autres > fichiers systemd par la suite > Merci d'avance pour vos relectures et commentaires, > amicalement, > bubu Détails. Amicalement, jipege --- /home/jpg1/Documents/traductions/l10n/manpage-fr/man1/fait/systemd.1/2024_05/systemd.1.po 2024-05-10 19:36:54.472520609 +0200 +++ /home/jpg1/Documents/traductions/l10n/manpage-fr/man1/fait/systemd.1/2024_05/systemd.1_jpg.po 2024-05-10 19:43:45.200090068 +0200 @@ -4,9 +4,9 @@ # bubu , 2023-2024. msgid "" msgstr "" -"Project-Id-Version: man-pages\n" +"Project-Id-Version: manpages-l10n 4.22.0\n" "POT-Creation-Date: 2024-05-01 15:55+0200\n" -"PO-Revision-Date: 2024-05-10 15:03+0200\n" +"PO-Revision-Date: 2024-05-10 19:43+0200\n" "Last-Translator: bubu \n" "Language-Team: French \n" "Language: fr_FR\n" @@ -37,9 +37,9 @@ msgid "systemd" msgstr "systemd" -#. - -#. * MAIN CONTENT STARTS HERE * -#. - +#. - +#. * MAIN CONTENT STARTS HERE * +#. - #. type: SH #: archlinux debian-bookworm debian-unstable fedora-40 fedora-rawhide #: mageia-cauldron opensuse-leap-15-6 opensuse-tumbleweed @@ -1732,7 +1732,7 @@ "Note that setting the regular I<$LESS> environment variable has no effect " "for B invocations by systemd tools\\&." msgstr "" -"Notez que le réglage de la variable d'environnement I<$LESS> habituelle n'a " +"Notez que le réglage de la variable d'environnement I<$LESS> normale n'a " "aucun effet sur les invocations de B par les outils de systemd\\&." #. type: Plain text @@ -1764,7 +1764,7 @@ "effect for B invocations by systemd tools\\&." msgstr "" "Notez que le réglage de la variable d'environnement I<$LESSCHARSET> " -"habituelle n'a aucun effet sur les invocations de B par les outils de " +"normale n'a aucun effet sur les invocations de B par les outils de " "systemd\\&." #. type: Plain text @@ -3499,5 +3499,5 @@ "When specified with a false argument, fall back to hybrid cgroup " "hierarchy\\&. The hybrid mode is deprecated\\&." msgstr "" -"Lorsque indiqué avec un argument faux, retourne vers la hiérarchie cgroup " +"Lorsqu'indiqué avec un argument faux, retourne vers la hiérarchie cgroup " "hybride\\&. Le mode hybride est obsolète\\&." signature.asc Description: This is a digitally signed message part
Re: [RFR] po4a://manpages-fr/ping.8.po/fr.po
Bonjour, Le vendredi 10 mai 2024 à 16:05 +0200, bu...@no-log.org a écrit : > Bonjour, > Voici une proposition de mise à jour pour ce fichier, > ci joint le diff. > amicalement, > bubu Préférences personnelles. J'essaye d'indiquer systématiquement le numéro de version de manpage-l10n Amicalement, jipege --- /home/jpg1/Documents/traductions/l10n/manpage-fr/man8/ping.8/2024_05/ping.8.po 2024-05-10 19:48:57.360747930 +0200 +++ /home/jpg1/Documents/traductions/l10n/manpage-fr/man8/ping.8/2024_05/ping.8_jpg.po 2024-05-10 19:52:23.450547740 +0200 @@ -5,9 +5,9 @@ # bubu , 2022-2024. msgid "" msgstr "" -"Project-Id-Version: manpages-fr\n" +"Project-Id-Version: manpages-l10n 4.22.0\n" "POT-Creation-Date: 2024-03-01 17:03+0100\n" -"PO-Revision-Date: 2024-05-10 15:43+0200\n" +"PO-Revision-Date: 2024-05-10 19:53+0200\n" "Last-Translator: bubu \n" "Language-Team: French \n" "Language: fr\n" @@ -38,9 +38,9 @@ msgid "iputils" msgstr "iputils" -#. - -#. * MAIN CONTENT STARTS HERE * -#. - +#. - +#. * MAIN CONTENT STARTS HERE * +#. - #. type: SH #: archlinux debian-bookworm debian-unstable fedora-40 fedora-rawhide #: mageia-cauldron opensuse-leap-15-6 opensuse-tumbleweed @@ -1290,7 +1290,7 @@ "kernel/pid_max> is 32768\\&. On the systems that use ping heavily and with " "I greater than 65535 collisions are bound to happen\\&." msgstr "" -"B utilise le PID pour avoir un numéro unique\\&. La valeur par défaut " +"B utilise le PID pour obtenir un numéro unique\\&. La valeur par défaut " "de I est 32768\\&. Sur les systèmes qui utilisent " "B intensément et avec I supérieur à 65535, des collisions " "sont inévitables\\&." signature.asc Description: This is a digitally signed message part
Re: [RFR] po4a://manpages-fr/grep.1.po/fr.po
Bonjour, Le vendredi 10 mai 2024 à 10:31 +0200, bu...@no-log.org a écrit : > Bonjour, > > en lisant la page de grep, j'y ai remarqué une coquille (manquait le x à > exclude), puis un détail > Voici du coup la version corrigée avec son 'x', entre autre, et le diff; > Merci pour vos commentaires, > Amicalement, > bubu Voici quelques suggestions (dont toute ligne au singulier et il n'y a pas de différence au singulier aussi) Amicalement, jipege --- /home/jpg1/Documents/traductions/l10n/manpage-fr/man1/fait/grep/2024_05/grep.1.po 2024-05-10 19:31:09.992294675 +0200 +++ /home/jpg1/Documents/traductions/l10n/manpage-fr/man1/fait/grep/2024_05/grep.1_jpg.po 2024-05-10 19:30:13.224924985 +0200 @@ -12,7 +12,7 @@ msgstr "" "Project-Id-Version: grep\n" "POT-Creation-Date: 2024-03-09 15:36+0100\n" -"PO-Revision-Date: 2024-05-09 23:36+0100\n" +"PO-Revision-Date: 2024-05-10 19:06+0200\n" "Last-Translator: Jean-Pierre Giraud \n" "Language-Team: French \n" "Language: fr\n" @@ -288,8 +288,8 @@ "Utiliser les motifs depuis I, un par ligne. Si cette option est " "utilisée plusieurs fois ou combinée avec l'option B<-e> (B<-\\^-regexp>), " "rechercher tous les motifs donnés. Un fichier vide ne contient pas de motif " -"et ne donne donc aucun résultat. Si le I est B<->, lire les motifs à " -"partir de l'entrée standard." +"et ne donne donc aucun résultat. Si le I est B<->, lire les motifs " +"à partir de l'entrée standard." #. type: TP #: archlinux debian-bookworm debian-unstable fedora-40 fedora-rawhide @@ -1333,15 +1333,14 @@ msgstr "" "Entre ces crochets, un I de caractères consiste en deux " "caractères séparés par un tiret. Il correspond avec n'importe quel caractère " -"compris entre les deux caractères (ceux-ci inclus), l'ordre des " -"caractères dépendant des paramètres régionaux (I, en anglais) " -"actuels. Ainsi, avec les paramètres par défaut («\\ C\\ »), B<[a-d]> est " -"équivalent à B<[abcd]>. Avec beaucoup de paramètres régionaux, les " -"caractères sont triés en suivant l'ordre des dictionnaires, et B<[a-d]> " -"n'est alors en général pas équivalent à B<[abcd]>, mais peut l'être à " -"B<[aBbCcDd]>, par exemple. Pour que ces listes aient le comportement " -"habituel de «\\ C\\ », vous pouvez positionner la variable d'environnement " -"B à la valeur B." +"compris entre les deux caractères (ceux-ci inclus), l'ordre des caractères " +"dépendant des paramètres régionaux (I, en anglais) actuels. Ainsi, " +"avec les paramètres par défaut («\\ C\\ »), B<[a-d]> est équivalent à " +"B<[abcd]>. Avec beaucoup de paramètres régionaux, les caractères sont triés " +" en suivant l'ordre des dictionnaires, et B<[a-d]> n'est alors en général " +"pas équivalent à B<[abcd]>, mais peut l'être à B<[aBbCcDd]>, par exemple. " +"Pour que ces listes aient le comportement habituel de «\\ C\\ », vous pouvez " +"positionner la variable d'environnement B à la valeur B." #. type: Plain text #: archlinux debian-bookworm debian-unstable fedora-40 fedora-rawhide @@ -1804,12 +1803,12 @@ "B and B at once to the same value. The default is a bold red text " "foreground over the current line background." msgstr "" -"Sous-chaîne SGR pour le texte non vide qui correspond dans toutes lignes qui " -"correspondent (c'est-à-dire une ligne sélectionnée quand l'option en ligne " -"de commande B<-v> n'est pas utilisée, ou une ligne de contexte quand B<-v> " -"est spécifiée). L'utiliser est équivalent à utiliser à la fois B et " -"B avec la même valeur. La valeur par défaut correspond à du texte rouge " -"en gras sur le fond de la ligne actuelle." +"Sous-chaîne SGR pour le texte non vide qui correspond dans toute ligne qui " +"correspond (c'est-à-dire une ligne sélectionnée quand l'option en ligne de " +"commande B<-v> n'est pas utilisée, ou une ligne de contexte quand B<-v> est " +"spécifiée). L'utiliser est équivalent à utiliser à la fois B et B " +"avec la même valeur. La valeur par défaut correspond à du texte rouge en " +"gras sur le fond de la ligne actuelle." #. type: TP #: archlinux debian-bookworm debian-unstable fedora-40 fedora-rawhide @@ -2376,7 +2375,7 @@ "B gère trois styles de syntaxe pour les expressions rationnelles\\ : " "«\\ simple\\ » (I, BRE), «\\ étendue\\ » (I, ERE) et " "« I » (PCRE). Dans la version \\s-1GNU\\s0 de B, il n'y a pas de " -"différences dans les fonctionnalités disponibles pour les styles I et " +"différence dans les fonctionnalités disponibles pour les styles I et " "I. Dans d'autres implémentations, les expressions rationnelles " "simples sont moins complètes. La description ci-dessous correspond aux " "expressions étendues, les différences avec les expressions simples étant " signature.asc Description: This is a digitally signed message part
