dear all: Using vcountPattern, i found some matched sequences. but those are not similar to the pattern. see such coding
rm(list=ls()) reads <- readFastq(fastqfile);#downloaded from http://biocluster.ucr.edu/~tbackman/query.fastq seqs <- sread(reads); PCR2rc<-DNAString("AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAACAAA") result <- vcountPattern(PCR2rc, seqs, max.mismatch=1, min.mismatch=0, with.indels=TRUE, algorithm="indels") reads <- reads[result] seqs <- sread(reads) sum(result) then using countPattern, i found they are really not match subject1 = "GTTGGTGCAAACATTAGTTCTTCTGTTGGTGCAACCTTTG" result <- countPattern(PCR2rc, subject1, max.mismatch=1, min.mismatch=0, with.indels=TRUE) [1] 0 shan gao [[alternative HTML version deleted]] _______________________________________________ Bioc-sig-sequencing mailing list Bioc-sig-sequencing@r-project.org https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing