Re: [algogeeks] c

[sharad kumar]

cos if u declare const u cant change na.but volatile changes na.so
practically u cant declareU cant do mtech at IIT and MBA at IIM at same
time rite???

On Sat, Jun 26, 2010 at 10:43 AM, sharad kumar wrote:

> no its not cos u have declared const and volatile hw is it possible
> can u go to IIT and IIM at same time
>
>   On Sat, Jun 26, 2010 at 9:22 AM, sharad kumar 
> wrote:
>
>> static const volatile int x;
>> Is the declaration valid
>> plzzz explain
>>
>> --
>> You received this message because you are subscribed to the Google Groups
>> "Algorithm Geeks" group.
>> To post to this group, send email to algoge...@googlegroups.com.
>> To unsubscribe from this group, send email to
>> algogeeks+unsubscr...@googlegroups.com
>> .
>> For more options, visit this group at
>> http://groups.google.com/group/algogeeks?hl=en.
>>
>
>
>
> --
> yezhu malai vaasa venkataramana Govinda Govinda
>



-- 
yezhu malai vaasa venkataramana Govinda Govinda

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] c

[sharad kumar]

no its not cos u have declared const and volatile hw is it possible
can u go to IIT and IIM at same time

On Sat, Jun 26, 2010 at 9:22 AM, sharad kumar wrote:

> static const volatile int x;
> Is the declaration valid
> plzzz explain
>
> --
> You received this message because you are subscribed to the Google Groups
> "Algorithm Geeks" group.
> To post to this group, send email to algoge...@googlegroups.com.
> To unsubscribe from this group, send email to
> algogeeks+unsubscr...@googlegroups.com
> .
> For more options, visit this group at
> http://groups.google.com/group/algogeeks?hl=en.
>



-- 
yezhu malai vaasa venkataramana Govinda Govinda

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] 23 candies among 7 kids

[harit agarwal]

look at this approach:

a1+a2+a3+a4+a5+a6+a7=23
now it means there are 23 choclates and 6 partitions(+ symbol) and arrange
these 23+6=29 items so it is 29!
now 23 choclates are identical so divide by 23!

so number of ways=29! / 23 !

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

[algogeeks] b tree

[sharad kumar]

Find the median in B-tree of order 4? Note that as the tree has order 4, it
is not a binary tree.

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

[algogeeks] Puzzle .

[sharad kumar]

There are two robot standing on two ends of a line, somewhere on the line
there is a point and I need to make both robot reach that point. Same
program is running in both robots. Only instruction allowed is : Move Left,
Move Right, Am I on point. Tell how both the robots will meet.

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

[algogeeks] c

[sharad kumar]

static const volatile int x;
Is the declaration valid
plzzz explain

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] c array

[Ashish kumar Jain]

I also tried the same on Cygwin which has GCC and G++ compilers installed.It
also did not throw any error to me for .c file and threw the following error
for .cpp file:

$ g++ practice.cpp
practice.cpp: In function `int main()':
practice.cpp:4: error: initializer-string for array of chars is too long

I ran this piece of code on GCC compiler:

#include
int main()
{
  char str[7]="strings";
  int i=printf("%s\n",str);
  printf("%d %d %d\n",i,sizeof(str)/sizeof(str[0]),strlen(str));
  return 0;
}

and it yielded:

kt...@akjlab /cygdrive/f/Code/linux
$ gcc practice.c

kt...@akjlab /cygdrive/f/Code/linux
$

kt...@akjlab /cygdrive/f/Code/linux
$

kt...@akjlab /cygdrive/f/Code/linux
$ ./a.exe
strings
8 7 7

Regards,

Ashish



On Fri, Jun 25, 2010 at 9:06 PM, Ashish kumar Jain
wrote:

> It is legal in ANSI C (and perhaps in a few pre-ANSI systems), though
> useful only in rare circumstances.
>
> This is running without any error on Dev cpp which has GCC compiler.It is
> illegal in C++ where strict type checking is already in place.
>
> If someone differs from me,please let me know how you ran this piece of
> code.First thing should be that it is a pure .c file and not .cpp file.
>
> Had it been not the case and you ran it in C++ environment,then it will
> surely throw error for array bounds overflow.
>
> Regards,
>
> Ashish
>
>
> On Sun, Jun 13, 2010 at 3:03 PM, sankalp srivastava <
> richi.sankalp1...@gmail.com> wrote:
>
>> don't ever use a TC compiler , the most obsolete and mad compiler of all .
>> Every compiler tries to fix the bug in ur code by some way or the other
>> using some .Even gcc has a lot of bugs , in the sense it will return an exit
>> status even if returning a void , but this is on ubuntu and haven't tries
>> mingW yet . Any
>>
>>
>> On Sun, Jun 13, 2010 at 1:47 PM, divya jain wrote:
>>
>>> i use tc
>>>
>>>
>>> On 13 June 2010 13:11, ram  wrote:
>>>
 @rohit bro

 http://www.mingw.org/

 *MinGW*, a contraction of "Minimalist GNU for Windows", is a port of
 the GNU Compiler Collection (GCC), and GNU Binutils, for use in the
 development of native Microsoft Windows applications.





 *From:* algogeeks@googlegroups.com [mailto:algoge...@googlegroups.com]
 *On Behalf Of *Rohit Saraf
 *Sent:* 13 June 2010 08:19

 *To:* algogeeks@googlegroups.com
 *Subject:* Re: [algogeeks] c array



 @ram : i guess you have used some longer string and not "strings"



 btw..  what is Mingw ?

 gcc/g++ is not mingw, i guess


 --
 Rohit Saraf
 Second Year Undergraduate,
 Dept. of Computer Science and Engineering
 IIT Bombay
 http://www.cse.iitb.ac.in/~rohitfeb14

 On Sun, Jun 13, 2010 at 8:13 AM, ram  wrote:

 D:\code\samplecode\main.cpp|5|error: initializer-string for array of
 chars is too long|



 I get this error on gcc (Mingw) .



 Though the array indexing starts from 0.

 The length specified in char str[7] is always straightforward . in this
 case char str[7]  . the length of str is seven not eight ;hence the error

 --

 ram



 *From:* algogeeks@googlegroups.com [mailto:algoge...@googlegroups.com]
 *On Behalf Of *sharad kumar
 *Sent:* 13 June 2010 07:59
 *To:* algogeeks@googlegroups.com
 *Subject:* Re: [algogeeks] c array



 hey array indexing starts from 0 rite??
 then y shld u get overflow in first place..
 s t  r  i n g s \0
 0 1 2 3 4 5 6 7

 On Sat, Jun 12, 2010 at 9:14 PM, divya 
 wrote:

 #include
 int main()
 {

 char str[7]="strings";
 printf("%s\n",str);
 return 0;
 }

 here i m nt getting overflow error whereas if i write stringss instead
 of strings then there is overflow error.. isnt null stored after s in
 strings nd 1st case shd also give overflow???

 --

 You received this message because you are subscribed to the Google
 Groups "Algorithm Geeks" group.
 To post to this group, send email to algoge...@googlegroups.com.

 To unsubscribe from this group, send email to
 algogeeks+unsubscr...@googlegroups.com
 .
 For more options, visit this group at
 http://groups.google.com/group/algogeeks?hl=en.




 --
 yezhu malai vaasa venkataramana Govinda Govinda

 --
 You received this message because you are subscribed to the Google
 Groups "Algorithm Geeks" group.
 To post to this group, send email to algoge...@googlegroups.com.
 To unsubscribe from this group, send email to
 algogeeks+unsubscr...@googlegroups.com.
 For more options, visit this group at
 http://groups.google.com/group/algogeeks?hl=en.

 --

 You received this message because

Re: [algogeeks] sort

[jalaj jaiswal]

if there is no space constraint we can use counting sort .. with O(logm)
space and time complexity will be O(n)

On Fri, Jun 25, 2010 at 5:51 PM, sharad kumar wrote:

> You are given an unordered sequence of n integers with many duplications,
> such that the number of distinct integers in the sequence is O(log n).
> Design a sorting algorithm and its necessary data structure(s), which can
> sort the sequence using at most O(n log(log n)) time.
>
> Give the detailed design.
>
> --
> You received this message because you are subscribed to the Google Groups
> "Algorithm Geeks" group.
> To post to this group, send email to algoge...@googlegroups.com.
> To unsubscribe from this group, send email to
> algogeeks+unsubscr...@googlegroups.com
> .
> For more options, visit this group at
> http://groups.google.com/group/algogeeks?hl=en.
>



-- 
With Regards,
Jalaj Jaiswal
+919026283397
B.TECH IT
IIIT ALLAHABAD

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] 23 candies among 7 kids

[Jitendra Kushwaha]

(1 + x + x^2 + x^3 + ... + x^23)  ^ 7
=  (1 + x + x^2 + x^3 + ... + x^23 + ... x^inf )  ^ 7
=  (1-x)^-7
= 1 + 7x + (7*8*x^2)/(1*2) + ...+   (7*8*...*29*x^23)/(1*2*3* ... * 23)
+ ...

now coefficient of x^23 is (7*8*...*29) / (1*2*3* ... * 23)
 =  (1*2*3*...*29) / ( (1*2*3..
*23) * (1*2* .. *6) )
 =  29! / ( 23! * 6!)
 =   29C23OR29C6

any mistake???

-- 
Regards
Jitendra Kushwaha
MNNIT, Allahabad

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] sort

[Amit Jaspal]

Put the numbers in the BST. Update the frequency. Print the numbers with
Inorder Traversal.
Height of Bst will be O(log(logn)).

On Fri, Jun 25, 2010 at 5:51 PM, sharad kumar wrote:

> You are given an unordered sequence of n integers with many duplications,
> such that the number of distinct integers in the sequence is O(log n).
> Design a sorting algorithm and its necessary data structure(s), which can
> sort the sequence using at most O(n log(log n)) time.
>
> Give the detailed design.
>
> --
> You received this message because you are subscribed to the Google Groups
> "Algorithm Geeks" group.
> To post to this group, send email to algoge...@googlegroups.com.
> To unsubscribe from this group, send email to
> algogeeks+unsubscr...@googlegroups.com
> .
> For more options, visit this group at
> http://groups.google.com/group/algogeeks?hl=en.
>

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

[algogeeks] Matrix Problem

[amit]

Given a matrix sorted row-wise and column-wise and a value X.
Can we find A[i1][j1] and A[i2][j2] such that there sum = X.

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] sort

[jalaj jaiswal]

you will have to call insert functuon for every integer

for 1 to n
 insert(int n , node *root)

wouldn't that be n*logn

correct me if i'm wrong..!!!


On Fri, Jun 25, 2010 at 10:37 PM, Anand  wrote:

> The most useful data structure would be BST.
> Each node will have data value and its count. count indicates the number of
> times it is repeated in a sequence. Below is the algo to creat a binary
> search tree.
>
> insert_node(int data, node root)
> {
>if(root == NULL)
>{
>root = malloc();
>root->right = NULL;
>root->left = NULL;
>root->data = data;
>root->count =1;
>}
>else if(root->data == data)
>{
>   root->count++;
>}
>else if(data < root->data)
>  root->left = insert_node(data, root->left);
>else
>  root->right = insert_node(data, root->right);
>
> }
> creation of binary search tree will take O(logn)
> Take inorder traversal of above binary tree to get the sorted sequence in
> O(nlog(logn)) also while doing inorder traversal while printing the root
> value also check the count and repeat value that many time.
> On Fri, Jun 25, 2010 at 5:21 AM, sharad kumar wrote:
>
>> You are given an unordered sequence of n integers with many duplications,
>> such that the number of distinct integers in the sequence is O(log n).
>> Design a sorting algorithm and its necessary data structure(s), which can
>> sort the sequence using at most O(n log(log n)) time.
>>
>> Give the detailed design.
>>
>> --
>> You received this message because you are subscribed to the Google Groups
>> "Algorithm Geeks" group.
>> To post to this group, send email to algoge...@googlegroups.com.
>> To unsubscribe from this group, send email to
>> algogeeks+unsubscr...@googlegroups.com
>> .
>> For more options, visit this group at
>> http://groups.google.com/group/algogeeks?hl=en.
>>
>
>  --
> You received this message because you are subscribed to the Google Groups
> "Algorithm Geeks" group.
> To post to this group, send email to algoge...@googlegroups.com.
> To unsubscribe from this group, send email to
> algogeeks+unsubscr...@googlegroups.com
> .
> For more options, visit this group at
> http://groups.google.com/group/algogeeks?hl=en.
>



-- 
With Regards,
Jalaj Jaiswal
+919026283397
B.TECH IT
IIIT ALLAHABAD

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] FIND DUPLICATE IN BINARY TREE

[Anurag Sharma]

@jalaj Tree may have negative values.

Anurag Sharma

On Fri, Jun 25, 2010 at 7:38 PM, jalaj jaiswal wrote:

> first do a traversal of the tree and find the maximum value
> now take an auxilarry aray a[MAX].. initialize this array to zero
>
> now traverse the tree and each time update the value in array
> a[valueintree]++;
> and keep a check,if the value is 2.if at any time any value is 2 after
> incrementing ...the index of array is the duplicate value in tree
>
> total time O(n)...
>
> but this method had space constraint... any one better ??
>
> On Fri, Jun 25, 2010 at 5:34 PM, RIDER  wrote:
>
>> you are given a binary tree (not a BST) .how to find is there is  any
>> element which occurs twice and if so what is value ?
>>
>> --
>> You received this message because you are subscribed to the Google Groups
>> "Algorithm Geeks" group.
>> To post to this group, send email to algoge...@googlegroups.com.
>> To unsubscribe from this group, send email to
>> algogeeks+unsubscr...@googlegroups.com
>> .
>> For more options, visit this group at
>> http://groups.google.com/group/algogeeks?hl=en.
>>
>>
>
>
> --
> With Regards,
> Jalaj Jaiswal
> +919026283397
> B.TECH IT
> IIIT ALLAHABAD
>
>  --
> You received this message because you are subscribed to the Google Groups
> "Algorithm Geeks" group.
> To post to this group, send email to algoge...@googlegroups.com.
> To unsubscribe from this group, send email to
> algogeeks+unsubscr...@googlegroups.com
> .
> For more options, visit this group at
> http://groups.google.com/group/algogeeks?hl=en.
>

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

[algogeeks] Puzzle

[ashish kumar]

You have a DNA string that you wish to analyze. Of particular interest
is which intervals of the string represent individual genes. You have
a number of "gene predictions", each of which assigns a score to an
interval within the DNA string, and you want to find the subset of
predictions such that the total score is maximized while avoiding
overlaps. A gene prediction is a triple of the form (start, stop,
score). start is the zero-based index of the first character in the
DNA string contained in the gene. stop is the index of the last
character contained in the gene. score is the score for the gene.


Input Specification

Your program will be passed the name of an input file on the command
line. The contents of that file are as follows.

The first line of the input contains only n, the length of the DNA
string you will be given.

The next ceiling(n / 80) lines each contain string of length 80 (or n
% 80 for the last line) containing only the characters 'A', 'C', 'G',
and 'T'. Concatenate these lines to get the entire DNA strand.

The next line contains only g, the number of gene predictions you will be given.

The next g lines each contain a whitespace-delimited triple of
integers of the form

  

representing a single gene prediction. No gene predictions will exceed
the bounds of the DNA string or be malformed (start is non-negative
and no more than stop, stop never exceeds n - 1).

Example Input:

100
GAACTATCGCCCGTGCGCATCGCCCGTCCGACCGGCCGTAAGTCTATCTCCCGAGCGGGCGCCCGATCTCAAGTGCACCT
CACGGCCTCACGACCGTGAG
8
43  70  27
3   18  24
65  99  45
20  39  26
45  74  26
10  28  20
78  97  23
0   9   22




Output Specification
Print to standard out the score of the best possible subset of the
gene predictions you are given such that no single index in the DNA
string is contained in more than one gene prediction, followed by a
newline. The total score is simply the sum of the scores of the gene
predictions included in your final result.

When constructing your output, you may only consider genes exactly as
they are described in the input. If you find the contents of a gene
replicated elsewhere in the DNA string, you are not allowed to treat
the second copy as a viable gene. Your solution must be fast and
efficient to be considered correct by the robot.

Example Output:

100

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] Re: sort

[Anand]

@Dave: you mean need to generate an AVL tree instead.

On Fri, Jun 25, 2010 at 12:24 PM, Dave  wrote:

> You'll have to create a balanced BST. Otherwise, depending on the
> order of the dataset, it might degenerate into a linked list, which
> doesn't make searching an O(log n) process.
>
> Dave
>
> On Jun 25, 12:07 pm, Anand  wrote:
> > The most useful data structure would be BST.
> > Each node will have data value and its count. count indicates the number
> of
> > times it is repeated in a sequence. Below is the algo to creat a binary
> > search tree.
> >
> > insert_node(int data, node root)
> > {
> >if(root == NULL)
> >{
> >root = malloc();
> >root->right = NULL;
> >root->left = NULL;
> >root->data = data;
> >root->count =1;
> >}
> >else if(root->data == data)
> >{
> >   root->count++;
> >}
> >else if(data < root->data)
> >  root->left = insert_node(data, root->left);
> >else
> >  root->right = insert_node(data, root->right);
> >
> > }
> >
> > creation of binary search tree will take O(logn)
> > Take inorder traversal of above binary tree to get the sorted sequence in
> > O(nlog(logn)) also while doing inorder traversal while printing the root
> > value also check the count and repeat value that many time.
> > On Fri, Jun 25, 2010 at 5:21 AM, sharad kumar  >wrote:
> >
> >
> >
> > > You are given an unordered sequence of n integers with many
> duplications,
> > > such that the number of distinct integers in the sequence is O(log n).
> > > Design a sorting algorithm and its necessary data structure(s), which
> can
> > > sort the sequence using at most O(n log(log n)) time.
> >
> > > Give the detailed design.
> >
> > > --
> > > You received this message because you are subscribed to the Google
> Groups
> > > "Algorithm Geeks" group.
> > > To post to this group, send email to algoge...@googlegroups.com.
> > > To unsubscribe from this group, send email to
> > > algogeeks+unsubscr...@googlegroups.com
> 
> > > .
> > > For more options, visit this group at
> > >http://groups.google.com/group/algogeeks?hl=en.- Hide quoted text -
> >
> > - Show quoted text -
>
> --
> You received this message because you are subscribed to the Google Groups
> "Algorithm Geeks" group.
> To post to this group, send email to algoge...@googlegroups.com.
> To unsubscribe from this group, send email to
> algogeeks+unsubscr...@googlegroups.com
> .
> For more options, visit this group at
> http://groups.google.com/group/algogeeks?hl=en.
>
>

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

[algogeeks] Re: sort

[Dave]

You'll have to create a balanced BST. Otherwise, depending on the
order of the dataset, it might degenerate into a linked list, which
doesn't make searching an O(log n) process.

Dave

On Jun 25, 12:07 pm, Anand  wrote:
> The most useful data structure would be BST.
> Each node will have data value and its count. count indicates the number of
> times it is repeated in a sequence. Below is the algo to creat a binary
> search tree.
>
> insert_node(int data, node root)
> {
>    if(root == NULL)
>    {
>        root = malloc();
>        root->right = NULL;
>        root->left = NULL;
>        root->data = data;
>        root->count =1;
>    }
>    else if(root->data == data)
>    {
>       root->count++;
>    }
>    else if(data < root->data)
>      root->left = insert_node(data, root->left);
>    else
>      root->right = insert_node(data, root->right);
>
> }
>
> creation of binary search tree will take O(logn)
> Take inorder traversal of above binary tree to get the sorted sequence in
> O(nlog(logn)) also while doing inorder traversal while printing the root
> value also check the count and repeat value that many time.
> On Fri, Jun 25, 2010 at 5:21 AM, sharad kumar wrote:
>
>
>
> > You are given an unordered sequence of n integers with many duplications,
> > such that the number of distinct integers in the sequence is O(log n).
> > Design a sorting algorithm and its necessary data structure(s), which can
> > sort the sequence using at most O(n log(log n)) time.
>
> > Give the detailed design.
>
> > --
> > You received this message because you are subscribed to the Google Groups
> > "Algorithm Geeks" group.
> > To post to this group, send email to algoge...@googlegroups.com.
> > To unsubscribe from this group, send email to
> > algogeeks+unsubscr...@googlegroups.com
> > .
> > For more options, visit this group at
> >http://groups.google.com/group/algogeeks?hl=en.- Hide quoted text -
>
> - Show quoted text -

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

[algogeeks] Re: Closest Pair Of Points

[Gene]

On Jun 25, 10:58 am, amit  wrote:
> Can any one explain how to find the closest pair of points given N
> points in 2-D .
> I have read this in google but i m not able to write pseudocode

I guess you mean in O(n log n), since the naive O(n^2) algorithm is
just

d = infinity
for all point pairs 
if (dist(p1, p2) < d) { closest = ; d = dist(p1,p2) }
return closest

For the standard divide-and-conquer algorithm, check this.

http://www.cs.ucsb.edu/~suri/cs235/ClosestPair.pdf

It's about as clear as it an be.

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] OS problems

[Anand]

1. Virtual memory depends upon the data lines of the processor if it 32 bit
than virtual memory would 2^32.

2. Number of logical address bits would be (2^10= 1024)10. and 8 data bits.




On Thu, Jun 24, 2010 at 9:20 PM, harit agarwal wrote:

> 1. the virtual memory size depends on the page size that the system is
> using...
> 2. logical address=5+10=15 bits + (some modifying bits if they are present
> like modified,copied etc..)
>
> --
> You received this message because you are subscribed to the Google Groups
> "Algorithm Geeks" group.
> To post to this group, send email to algoge...@googlegroups.com.
> To unsubscribe from this group, send email to
> algogeeks+unsubscr...@googlegroups.com
> .
> For more options, visit this group at
> http://groups.google.com/group/algogeeks?hl=en.
>

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] sort

[Anand]

The most useful data structure would be BST.
Each node will have data value and its count. count indicates the number of
times it is repeated in a sequence. Below is the algo to creat a binary
search tree.

insert_node(int data, node root)
{
   if(root == NULL)
   {
   root = malloc();
   root->right = NULL;
   root->left = NULL;
   root->data = data;
   root->count =1;
   }
   else if(root->data == data)
   {
  root->count++;
   }
   else if(data < root->data)
 root->left = insert_node(data, root->left);
   else
 root->right = insert_node(data, root->right);

}
creation of binary search tree will take O(logn)
Take inorder traversal of above binary tree to get the sorted sequence in
O(nlog(logn)) also while doing inorder traversal while printing the root
value also check the count and repeat value that many time.
On Fri, Jun 25, 2010 at 5:21 AM, sharad kumar wrote:

> You are given an unordered sequence of n integers with many duplications,
> such that the number of distinct integers in the sequence is O(log n).
> Design a sorting algorithm and its necessary data structure(s), which can
> sort the sequence using at most O(n log(log n)) time.
>
> Give the detailed design.
>
> --
> You received this message because you are subscribed to the Google Groups
> "Algorithm Geeks" group.
> To post to this group, send email to algoge...@googlegroups.com.
> To unsubscribe from this group, send email to
> algogeeks+unsubscr...@googlegroups.com
> .
> For more options, visit this group at
> http://groups.google.com/group/algogeeks?hl=en.
>

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] c array

[Ashish kumar Jain]

It is legal in ANSI C (and perhaps in a few pre-ANSI systems), though useful
only in rare circumstances.

This is running without any error on Dev cpp which has GCC compiler.It is
illegal in C++ where strict type checking is already in place.

If someone differs from me,please let me know how you ran this piece of
code.First thing should be that it is a pure .c file and not .cpp file.

Had it been not the case and you ran it in C++ environment,then it will
surely throw error for array bounds overflow.

Regards,

Ashish

On Sun, Jun 13, 2010 at 3:03 PM, sankalp srivastava <
richi.sankalp1...@gmail.com> wrote:

> don't ever use a TC compiler , the most obsolete and mad compiler of all .
> Every compiler tries to fix the bug in ur code by some way or the other
> using some .Even gcc has a lot of bugs , in the sense it will return an exit
> status even if returning a void , but this is on ubuntu and haven't tries
> mingW yet . Any
>
>
> On Sun, Jun 13, 2010 at 1:47 PM, divya jain wrote:
>
>> i use tc
>>
>>
>> On 13 June 2010 13:11, ram  wrote:
>>
>>> @rohit bro
>>>
>>> http://www.mingw.org/
>>>
>>> *MinGW*, a contraction of "Minimalist GNU for Windows", is a port of the
>>> GNU Compiler Collection (GCC), and GNU Binutils, for use in the development
>>> of native Microsoft Windows applications.
>>>
>>>
>>>
>>>
>>>
>>> *From:* algogeeks@googlegroups.com [mailto:algoge...@googlegroups.com] *On
>>> Behalf Of *Rohit Saraf
>>> *Sent:* 13 June 2010 08:19
>>>
>>> *To:* algogeeks@googlegroups.com
>>> *Subject:* Re: [algogeeks] c array
>>>
>>>
>>>
>>> @ram : i guess you have used some longer string and not "strings"
>>>
>>>
>>>
>>> btw..  what is Mingw ?
>>>
>>> gcc/g++ is not mingw, i guess
>>>
>>>
>>> --
>>> Rohit Saraf
>>> Second Year Undergraduate,
>>> Dept. of Computer Science and Engineering
>>> IIT Bombay
>>> http://www.cse.iitb.ac.in/~rohitfeb14
>>>
>>> On Sun, Jun 13, 2010 at 8:13 AM, ram  wrote:
>>>
>>> D:\code\samplecode\main.cpp|5|error: initializer-string for array of
>>> chars is too long|
>>>
>>>
>>>
>>> I get this error on gcc (Mingw) .
>>>
>>>
>>>
>>> Though the array indexing starts from 0.
>>>
>>> The length specified in char str[7] is always straightforward . in this
>>> case char str[7]  . the length of str is seven not eight ;hence the error
>>>
>>> --
>>>
>>> ram
>>>
>>>
>>>
>>> *From:* algogeeks@googlegroups.com [mailto:algoge...@googlegroups.com] *On
>>> Behalf Of *sharad kumar
>>> *Sent:* 13 June 2010 07:59
>>> *To:* algogeeks@googlegroups.com
>>> *Subject:* Re: [algogeeks] c array
>>>
>>>
>>>
>>> hey array indexing starts from 0 rite??
>>> then y shld u get overflow in first place..
>>> s t  r  i n g s \0
>>> 0 1 2 3 4 5 6 7
>>>
>>> On Sat, Jun 12, 2010 at 9:14 PM, divya  wrote:
>>>
>>> #include
>>> int main()
>>> {
>>>
>>> char str[7]="strings";
>>> printf("%s\n",str);
>>> return 0;
>>> }
>>>
>>> here i m nt getting overflow error whereas if i write stringss instead
>>> of strings then there is overflow error.. isnt null stored after s in
>>> strings nd 1st case shd also give overflow???
>>>
>>> --
>>>
>>> You received this message because you are subscribed to the Google Groups
>>> "Algorithm Geeks" group.
>>> To post to this group, send email to algoge...@googlegroups.com.
>>>
>>> To unsubscribe from this group, send email to
>>> algogeeks+unsubscr...@googlegroups.com
>>> .
>>> For more options, visit this group at
>>> http://groups.google.com/group/algogeeks?hl=en.
>>>
>>>
>>>
>>>
>>> --
>>> yezhu malai vaasa venkataramana Govinda Govinda
>>>
>>> --
>>> You received this message because you are subscribed to the Google Groups
>>> "Algorithm Geeks" group.
>>> To post to this group, send email to algoge...@googlegroups.com.
>>> To unsubscribe from this group, send email to
>>> algogeeks+unsubscr...@googlegroups.com.
>>> For more options, visit this group at
>>> http://groups.google.com/group/algogeeks?hl=en.
>>>
>>> --
>>>
>>> You received this message because you are subscribed to the Google Groups
>>> "Algorithm Geeks" group.
>>> To post to this group, send email to algoge...@googlegroups.com.
>>> To unsubscribe from this group, send email to
>>> algogeeks+unsubscr...@googlegroups.com
>>> .
>>> For more options, visit this group at
>>> http://groups.google.com/group/algogeeks?hl=en.
>>>
>>>
>>>
>>> --
>>> You received this message because you are subscribed to the Google Groups
>>> "Algorithm Geeks" group.
>>> To post to this group, send email to algoge...@googlegroups.com.
>>> To unsubscribe from this group, send email to
>>> algogeeks+unsubscr...@googlegroups.com.
>>> For more options, visit this group at
>>> http://groups.google.com/group/algogeeks?hl=en.
>>>
>>> --
>>> You received this message because you are subscribed to the Google Groups
>>> "Algorithm Geeks" group.
>>> To post to this group, send email to algoge...@googlegroups.com.
>>> To unsubscribe from this group, send email to
>>> alg

[algogeeks] 2d array

[sharad kumar]

You have been given a Two Dimensional Array and One Dimensional Array.. You
have to return true if 2D array consists of given 1D Array… 2D array
Consists of 1D array means all the elements of 1d are present contiguously
in left side, right side, in up or in down directions in 2d array..
if 2d array is
2 5 6 7
4 6 8 1
2 5 3 3
0 6 1 9

and 1d array is 6 7 then return true its found at a[0][2] to right
and 1d array is 2 5 6 8 3 then return false
and 1d array is 6 5 6 then return true its found at a[3][1] to up
and 1d array is 3 3 5 then return true its found at a[2][3] to left

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] FIND DUPLICATE IN BINARY TREE

[jalaj jaiswal]

first do a traversal of the tree and find the maximum value
now take an auxilarry aray a[MAX].. initialize this array to zero

now traverse the tree and each time update the value in array
a[valueintree]++;
and keep a check,if the value is 2.if at any time any value is 2 after
incrementing ...the index of array is the duplicate value in tree

total time O(n)...

but this method had space constraint... any one better ??

On Fri, Jun 25, 2010 at 5:34 PM, RIDER  wrote:

> you are given a binary tree (not a BST) .how to find is there is  any
> element which occurs twice and if so what is value ?
>
> --
> You received this message because you are subscribed to the Google Groups
> "Algorithm Geeks" group.
> To post to this group, send email to algoge...@googlegroups.com.
> To unsubscribe from this group, send email to
> algogeeks+unsubscr...@googlegroups.com
> .
> For more options, visit this group at
> http://groups.google.com/group/algogeeks?hl=en.
>
>


-- 
With Regards,
Jalaj Jaiswal
+919026283397
B.TECH IT
IIIT ALLAHABAD

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] FIND DUPLICATE IN BINARY TREE

[Anurag Sharma]

Make a Self Balancing BST like RB Tree or AVL Tree, lets call it T. ( O(n) )
Perform an inorder traversal of the Binary tree and for every element keep
it inserting it to T only if its not found in T. If its found, then its
repeated. (  O(logn) )

Total Time: O(nlogn)
Total Space: O(n)

Or use a hashmap instead of RB-Tree
Total Time: O(n)
Total Space: O(1)

Anurag Sharma


On Fri, Jun 25, 2010 at 5:34 PM, RIDER  wrote:

> you are given a binary tree (not a BST) .how to find is there is  any
> element which occurs twice and if so what is value ?
>
> --
> You received this message because you are subscribed to the Google Groups
> "Algorithm Geeks" group.
> To post to this group, send email to algoge...@googlegroups.com.
> To unsubscribe from this group, send email to
> algogeeks+unsubscr...@googlegroups.com
> .
> For more options, visit this group at
> http://groups.google.com/group/algogeeks?hl=en.
>
>

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] FIND DUPLICATE IN BINARY TREE

[mandy4u4ever]

I think we can traverse it using any of the algorithms and chk for
duplicates.

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

[algogeeks] Closest Pair Of Points

[amit]

Can any one explain how to find the closest pair of points given N
points in 2-D .
I have read this in google but i m not able to write pseudocode

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] FIND DUPLICATE IN BINARY TREE

[Anurag Sharma]

PS: read 'hashmap' in my previous post as 'hashtable'

Anurag Sharma


On Fri, Jun 25, 2010 at 5:55 PM, Anurag Sharma wrote:

> Make a Self Balancing BST like RB Tree or AVL Tree, lets call it T. ( O(n)
> )
> Perform an inorder traversal of the Binary tree and for every element keep
> it inserting it to T only if its not found in T. If its found, then its
> repeated. (  O(logn) )
>
> Total Time: O(nlogn)
> Total Space: O(n)
>
> Or use a hashmap instead of RB-Tree
> Total Time: O(n)
> Total Space: O(1)
>
> Anurag Sharma
>
>
>
> On Fri, Jun 25, 2010 at 5:34 PM, RIDER  wrote:
>
>> you are given a binary tree (not a BST) .how to find is there is  any
>> element which occurs twice and if so what is value ?
>>
>> --
>> You received this message because you are subscribed to the Google Groups
>> "Algorithm Geeks" group.
>> To post to this group, send email to algoge...@googlegroups.com.
>> To unsubscribe from this group, send email to
>> algogeeks+unsubscr...@googlegroups.com
>> .
>> For more options, visit this group at
>> http://groups.google.com/group/algogeeks?hl=en.
>>
>>
>

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

[algogeeks] sort

[sharad kumar]

You are given an unordered sequence of n integers with many duplications,
such that the number of distinct integers in the sequence is O(log n).
Design a sorting algorithm and its necessary data structure(s), which can
sort the sequence using at most O(n log(log n)) time.

Give the detailed design.

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

[algogeeks] FIND DUPLICATE IN BINARY TREE

[RIDER]

you are given a binary tree (not a BST) .how to find is there is  any
element which occurs twice and if so what is value ?

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] Re: There is an array of odd and even numbers. Now, sort them in such a way that the top portion of the array contains odd numbers, bottom portion contains even numbers

[manoj janoti]

what will happen if the values are " -6,7,5,8,3,4 " i.e if there are some of
negative values in the array

On Fri, Jun 25, 2010 at 4:42 PM, Xin  wrote:

> Do normal sorting, but when odd number take the negative value of if.
> e.g. 7,5,8,3,4 -->  -7,-5,8,-3,4
>
> --
> You received this message because you are subscribed to the Google Groups
> "Algorithm Geeks" group.
> To post to this group, send email to algoge...@googlegroups.com.
> To unsubscribe from this group, send email to
> algogeeks+unsubscr...@googlegroups.com
> .
> For more options, visit this group at
> http://groups.google.com/group/algogeeks?hl=en.
>
>

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

[algogeeks] Re: There is an array of odd and even numbers. Now, sort them in such a way that the top portion of the array contains odd numbers, bottom portion contains even numbers

[Xin]

Do normal sorting, but when odd number take the negative value of if.
e.g. 7,5,8,3,4 -->  -7,-5,8,-3,4

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] Re: There is an array of odd and even numbers. Now, sort them in such a way that the top portion of the array contains odd numbers, bottom portion contains even numbers

[divya jain]

@ gurav vivek

i think u r only exchanging odd and even.. only putting even to end and odd
in front and not doing descending sorting on odds and ascending on even..

plz correct me if i hv missed something..

On 24 June 2010 22:49, Vivek Sundararajan  wrote:

> Hi, how about this -
>
> Do a merge sort, now, while merging two sorted list, give more priority to
> odd numbers :)
>
> I believe this falls into the right solutions :)
>
> Any breaking cases?
>
>
> On 24 June 2010 09:41, Gaurav Singh  wrote:
>
>> I think in this case, bubble sorting will be a better idea. just
>> replace the condition of comparison with the condition that earlier
>> number is even and later number is odd. I mean we can do sumthing lyk
>> this :
>>
>> for i=1 to n-1
>>  for j=1 to n-i-1
>> if iseven(ar[j]) AND (NOT iseven(ar[j+1]))
>> then   swap both of them.
>>
>> Please correct me if I am wrong somewhere.
>>
>> --
>> You received this message because you are subscribed to the Google Groups
>> "Algorithm Geeks" group.
>> To post to this group, send email to algoge...@googlegroups.com.
>> To unsubscribe from this group, send email to
>> algogeeks+unsubscr...@googlegroups.com
>> .
>> For more options, visit this group at
>> http://groups.google.com/group/algogeeks?hl=en.
>>
>>
>
>
> --
> "Reduce, Reuse and Recycle"
> Regards,
> Vivek.S
>
> --
> You received this message because you are subscribed to the Google Groups
> "Algorithm Geeks" group.
> To post to this group, send email to algoge...@googlegroups.com.
> To unsubscribe from this group, send email to
> algogeeks+unsubscr...@googlegroups.com
> .
> For more options, visit this group at
> http://groups.google.com/group/algogeeks?hl=en.
>

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

[algogeeks] Re: Find the next number for a given number without using any arithmetic operators(use bit operations)

[vikas kumar]

adder with add value 1

On Jun 24, 8:30 pm, jaladhi dave  wrote:
> Another approach :http://codepad.org/CqKIZJeO
>
> On Thu, Jun 24, 2010 at 7:31 PM, mohit ranjan wrote:
>
> > @Dave
>
> > Can u plz explain the logic behind this..
>
> > Mohit
>
> > On Thu, Jun 24, 2010 at 12:44 AM, Dave  wrote:
>
> >> c = 1
> >> repeat
> >>    d = n and c
> >>    n = n xor c
> >>    c = d left shifted by 1
> >> until c = 0
>
> >> Dave
>
> >> On Jun 23, 11:05 am, vijay  wrote:
> >> >  Find the next number for a given number without using any arithmetic
> >> > operators(use bit operations)
>
> >> --
> >> You received this message because you are subscribed to the Google Groups
> >> "Algorithm Geeks" group.
> >> To post to this group, send email to algoge...@googlegroups.com.
> >> To unsubscribe from this group, send email to
> >> algogeeks+unsubscr...@googlegroups.com
> >> .
> >> For more options, visit this group at
> >>http://groups.google.com/group/algogeeks?hl=en.
>
> >  --
> > You received this message because you are subscribed to the Google Groups
> > "Algorithm Geeks" group.
> > To post to this group, send email to algoge...@googlegroups.com.
> > To unsubscribe from this group, send email to
> > algogeeks+unsubscr...@googlegroups.com
> > .
> > For more options, visit this group at
> >http://groups.google.com/group/algogeeks?hl=en.

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

[algogeeks] Re: Find the next number for a given number without using any arithmetic operators(use bit operations)

[vikas kumar]

adder with add value 1

On Jun 24, 8:30 pm, jaladhi dave  wrote:
> Another approach :http://codepad.org/CqKIZJeO
>
> On Thu, Jun 24, 2010 at 7:31 PM, mohit ranjan wrote:
>
> > @Dave
>
> > Can u plz explain the logic behind this..
>
> > Mohit
>
> > On Thu, Jun 24, 2010 at 12:44 AM, Dave  wrote:
>
> >> c = 1
> >> repeat
> >>    d = n and c
> >>    n = n xor c
> >>    c = d left shifted by 1
> >> until c = 0
>
> >> Dave
>
> >> On Jun 23, 11:05 am, vijay  wrote:
> >> >  Find the next number for a given number without using any arithmetic
> >> > operators(use bit operations)
>
> >> --
> >> You received this message because you are subscribed to the Google Groups
> >> "Algorithm Geeks" group.
> >> To post to this group, send email to algoge...@googlegroups.com.
> >> To unsubscribe from this group, send email to
> >> algogeeks+unsubscr...@googlegroups.com
> >> .
> >> For more options, visit this group at
> >>http://groups.google.com/group/algogeeks?hl=en.
>
> >  --
> > You received this message because you are subscribed to the Google Groups
> > "Algorithm Geeks" group.
> > To post to this group, send email to algoge...@googlegroups.com.
> > To unsubscribe from this group, send email to
> > algogeeks+unsubscr...@googlegroups.com
> > .
> > For more options, visit this group at
> >http://groups.google.com/group/algogeeks?hl=en.

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] OS problems

[harit agarwal]

1. the virtual memory size depends on the page size that the system is
using...
2. logical address=5+10=15 bits + (some modifying bits if they are present
like modified,copied etc..)

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.

Re: [algogeeks] n ary tree

[nisha goyal]

ok thanks :)

On Mon, Jun 21, 2010 at 8:41 AM, sharad kumar wrote:

> sry ..whatever u have posted ...i hve posted this approach mistakenly in
> lexographically next string waale mewaise  i think this approach
> works
>
> --
> You received this message because you are subscribed to the Google Groups
> "Algorithm Geeks" group.
> To post to this group, send email to algoge...@googlegroups.com.
> To unsubscribe from this group, send email to
> algogeeks+unsubscr...@googlegroups.com
> .
> For more options, visit this group at
> http://groups.google.com/group/algogeeks?hl=en.
>

-- 
You received this message because you are subscribed to the Google Groups 
"Algorithm Geeks" group.
To post to this group, send email to algoge...@googlegroups.com.
To unsubscribe from this group, send email to 
algogeeks+unsubscr...@googlegroups.com.
For more options, visit this group at 
http://groups.google.com/group/algogeeks?hl=en.