Hello, I am using the pegas R package to assign sequences into haplotypes.
I recently tried out a test examples with 4 sequences. 2 of the sequences (A and B) are identical, 1 sequence (Seq C) differs from these at only one position (pos 648). The 4th sequence (Seq D) is identical to all but shorter so has no residues at the determinant position 648. (See image below) So correctly pegas assigns A and B to haplotype I and C to haplotype II. However it also assigns D to I, despite there being no information at which residue is at the determinant position. I just wanted to know in such cases as D when there is missing information, does pegas just randomly assign to a haplotype? aln (633..663) names [A] CCCGATTTTATATCAACATTTATTT------ [D] CCCGATTTT---------------------- [B] CCCGATTTTATATCAACATTTATTT------ [C] CCCGATTTTATATCACCATTTATTTTGATTT Thanks and best wishes, Hirra University of Manchester Student. [[alternative HTML version deleted]] _______________________________________________ R-sig-phylo mailing list - R-sig-phylo@r-project.org https://stat.ethz.ch/mailman/listinfo/r-sig-phylo Searchable archive at http://www.mail-archive.com/r-sig-phylo@r-project.org/