Hi Torsten Thanks for that. I have fixed that and I hope to get that in the development version in the next few days.
However, there is still a problem that has been mentioned before on the list in that Artemis does not yet take into account column 1 in GFF3 (the "ID of the landmark used to establish the coordinate system"). This means feature positions that are not on the first sequence are wrong. I hope to get this fixed soon as well. Regards Tim On 3/11/09 12:28 AM, "Torsten Seemann" <torsten.seem...@infotech.monash.edu.au> wrote: > I've been migrating most of my software/scripts over to GFF3, and have > encountered a possible bug with Artemis (v11) on Linux x86_64. > > When the GFF3 has multiple sequences in the ##FASTA section, Artemis dies > with: > > Exception in thread "AWT-EventQueue-0" java.lang.ClassCastException: > uk.ac.sanger.artemis.io.EmblStreamFeature > at > uk.ac.sanger.artemis.io.GFFDocumentEntry.combineGeneFeatures(GFFDocumentEntry. > java:166) > at uk.ac.sanger.artemis.io.GFFDocumentEntry.<init>(GFFDocumentEntry.java:75) > > However, if i REMOVE the >region00001 sequence so there is only the > one >Seq sequence, all is ok. The extra sequences in the ##FASTA > section are commonly used to store CDS translations, or when the GFF > covers lots of sequences eg. contigs in an assembly. > > I have attached a .GFF3 file which causes this (and inlined it below > for completeness). > > ##gff-version 3 > Seq vbc region 20 60 . + . ID=region00001;product=Junk DNA > ##FASTA >> Seq > ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT > GC >> region00001 > GCATGCATGCATGCATGCATGCATGCATGCATGCATGCATG > > Thank you. _______________________________________________ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users