Hmm. Not seeing the '>.' anywhere. Or did you mean the '.' as a regex character?
On 4/12/20 at 8:01 AM, achim.quai...@gmail.com (archaeal) wrote: > Hello, > I would like to detect the lines starting with >.+ and replace all U with T > in the following line, but not in the line starting with > > Example: > > >NeiUe166 1551 bp rna > AGAGAUUGAACAUAAGAGUUUGAUCCUGGCUCAGAUUGAACGCUGGCGGCAUGCUUU > >Unc31652 1491 bp rna > AGGGUUUGAUCAUGGCUCAGGACGAACGCUGGCGGUGCGCCUUAUGCAUGCAAGUCG > >Unc31653 1469 bp rna > AGGGUUUGAUCAUGGCUCAGAACGAACGCUGGCGGCAUGCUUCAGACAUGCAAGUCG > > should look like: > >NeiUe166 1551 bp rna > AGAGATTGAACATAAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCATGCTTT > >Unc31652 1491 bp rna > AGGGTTTGATCATGGCTCAGGACGAACGCTGGCGGTGCGCCTTATGCATGCAAGTCG > >Unc31653 1469 bp rna > AGGGTTTGATCATGGCTCAGAACGAACGCTGGCGGCATGCTTCAGACATGCAAGTCG > > The search pattern should find the >.. line but make changes only in the > next line > Another possibility would be to search just in the "second" line for U and > replace with T > > It would be great if someone has an idea. > > Thanks a lot > archaeal > > -- - Bruce _bruce__van_allen__santa_cruz__ca_ -- This is the BBEdit Talk public discussion group. If you have a feature request or need technical support, please email "supp...@barebones.com" rather than posting here. Follow @bbedit on Twitter: <https://twitter.com/bbedit> --- You received this message because you are subscribed to the Google Groups "BBEdit Talk" group. To unsubscribe from this group and stop receiving emails from it, send an email to bbedit+unsubscr...@googlegroups.com. To view this discussion on the web visit https://groups.google.com/d/msgid/bbedit/r480Ps-10146i-31D123048D944FBDBD58DDD9AA8799A6%40Forest.local.
