First of all, sorry for my poor english. I work with DNA sequence and want to extract relevant motives of course using regular expression. A concrete example will be better than a long description of my problem, so :
Here is a string corresponding to my DNA strand : cgttgctagctgctatcgatgtgctagtcgatgctagtgcatgcgtagtgcagtcatatgctaggcat I want to extract all the substrings beginning with tag and finishing with tag including substrings with same start point but different length like : tagctgctatcgatgtgctag tagctgctatcgatgtgctagtcgatgctag tagctgctatcgatgtgctagtcgatgctagtgcatgcgtag How to write a regular expression which will not increase the value pos() after finding one match but keep the same value of pos() and extract all sequences with different lengths ? To sum up, if I have this sequence : taggcgttatcgctagcgcatcgataggctactattcgtagcc My regular expression must extract : taggcgttatcgctag taggcgttatcgctagcgcatcgatag taggcgttatcgctagcgcatcgataggctactattcgtag tagcgcatcgatag tagcgcatcgataggctactattcgtag taggctactattcgtag Thanks for any help ... -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]