Hello everyone,

It is very easy to display one sequence of DNA from the mouse genome.

For example

> library(BSgenome.Mmusculus.UCSC.mm9)
> DNAString(Mmusculus$chr1)[100000000:100000050]
  51-letter "DNAString" instance
seq: GGACTGCTGTTGCTGATTCATGTTTGATGTTTTAGACTGCTAATATCCTGA


My question:

Now lets say I have a BED-like list of genomic spaces like this

> head(A[ , c("chr", "start", "end")])
   chr   start     end
1 chr1 3644952 3649720
2 chr1 4599146 4601342
3 chr1 5015865 5018830
4 chr1 5072928 5076881
5 chr1 5504220 5507065
6 chr1 5513886 5516391

How do I display many sequences from different chromosomes?


Another question:

I wish to add these sequences to my BED-like data.frame as a new
field. How do I convert them to strings?


In my defense:

The first question is not covered in the documentation of
BSgenome.Mmusculus.UCSC.mm9.

Thank you,

Ivan


Ivan Gregoretti, PhD
National Institute of Diabetes and Digestive and Kidney Diseases
National Institutes of Health
5 Memorial Dr, Building 5, Room 205.
Bethesda, MD 20892. USA.
Phone: 1-301-496-1592
Fax: 1-301-496-9878

_______________________________________________
Bioc-sig-sequencing mailing list
[email protected]
https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing

Reply via email to