My guess is that the code has new line and carriage return characters. These wouldn't show up on output (as they are not valid HTML directives), but they would show up in the CFFILE output as they are valid within a text document. When you write to the file try replacing them out:
REReplace(OutputText, "[\s]+", "", "ALL") This replaces out space characters [\s] which should include the new lines. ....................... Ben Nadel Web Developer Nylon Technology 6 West 14th Street New York, NY 10011 212.691.1134 212.691.3477 fax www.nylontechnology.com "Vote for Pedro" -----Original Message----- From: Richard Colman [mailto:[EMAIL PROTECTED] Sent: Wednesday, November 30, 2005 11:22 PM To: CF-Talk Subject: strange CFFILE output behavior CFFILE seems to be putting extra linefeeds or carriage returns into the output written to a file. For example, Using: <cfset myoutput = "#replace(string2, " ", "","all")#;"> Here is my contents: GATGAGGAGGAGGTGGTGCTTGTGTGCGACAAGGTCATTGAGGAGGCTGACTTGGACGGTGACGGCAAGC TGGGCTTTGCTGACTTCGAGGACATGATTGCCAAGGCCCCTGACTTCCTCAGCACTTTCCACATCCGGAT CTGA ; ATGCAATTAGCTTTTCTCCATGGAATCCTTCTGTACATGATGAAGCCAGAGAAAAGATGCTGACTCAGAA AAAGCCTGAAGAACAGCACAATAAAAGTGTTCATGTTGCTGGCCTGTCATGGGTAAAGCCTGGCTCAGTA CAGCCTTTCAGTAAAGAAGAGAAAACAGTGGCGACTTAA ; Which is exactly what I want. However, when I put it into a CFFILE like: <cffile action="append" file="c:\inetpub\wwwroot\coda\dna.txt" output = "#myoutput#" addnewline="no"> I get: GATGAGGAGGAGGTGGTGCTTGTGTGCGACAAGGTCATTGAGGAGGCTGACTTGGACGGTGACGGCAAGC TGGGCTTTGCTGACTTCGAGGACATGATTGCCAAGGCCCCTGACTTCCTCAGCACTTTCCACATCCGGAT CTGA ; ATGCAATTAGCTTTTCTCCATGGAATCCTTCTGTACATGATGAAGCCAGAGAAAAGATGCTGACTCAGAA AAAGCCTGAAGAACAGCACAATAAAAGTGTTCATGTTGCTGGCCTGTCATGGGTAAAGCCTGGCTCAGTA CAGCCTTTCAGTAAAGAAGAGAAAACAGTGGCGACTTAA ; Which is not what I want. Any idea why the extra blank lines? TNX for any help. Rick. ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~| Logware (www.logware.us): a new and convenient web-based time tracking application. Start tracking and documenting hours spent on a project or with a client with Logware today. Try it for free with a 15 day trial account. http://www.houseoffusion.com/banners/view.cfm?bannerid=67 Message: http://www.houseoffusion.com/lists.cfm/link=i:4:225811 Archives: http://www.houseoffusion.com/cf_lists/threads.cfm/4 Subscription: http://www.houseoffusion.com/lists.cfm/link=s:4 Unsubscribe: http://www.houseoffusion.com/cf_lists/unsubscribe.cfm?user=11502.10531.4 Donations & Support: http://www.houseoffusion.com/tiny.cfm/54
