http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-ec2/src/test/java/org/apache/airavata/gfac/ec2/EC2ProviderTest.java ---------------------------------------------------------------------- diff --git a/modules/gfac/gfac-ec2/src/test/java/org/apache/airavata/gfac/ec2/EC2ProviderTest.java b/modules/gfac/gfac-ec2/src/test/java/org/apache/airavata/gfac/ec2/EC2ProviderTest.java deleted file mode 100644 index 9f86197..0000000 --- a/modules/gfac/gfac-ec2/src/test/java/org/apache/airavata/gfac/ec2/EC2ProviderTest.java +++ /dev/null @@ -1,195 +0,0 @@ -///* -// * -// * Licensed to the Apache Software Foundation (ASF) under one -// * or more contributor license agreements. See the NOTICE file -// * distributed with this work for additional information -// * regarding copyright ownership. The ASF licenses this file -// * to you under the Apache License, Version 2.0 (the -// * "License"); you may not use this file except in compliance -// * with the License. You may obtain a copy of the License at -// * -// * http://www.apache.org/licenses/LICENSE-2.0 -// * -// * Unless required by applicable law or agreed to in writing, -// * software distributed under the License is distributed on an -// * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY -// * KIND, either express or implied. See the License for the -// * specific language governing permissions and limitations -// * under the License. -// * -// */ -// -//package org.apache.airavata.gfac.ec2; -// -//import org.airavata.appcatalog.cpi.AppCatalog; -//import org.apache.aiaravata.application.catalog.data.impl.AppCatalogFactory; -//import org.apache.airavata.commons.gfac.type.*; -//import org.apache.airavata.gfac.GFacConfiguration; -//import org.apache.airavata.gfac.GFacException; -//import org.apache.airavata.gfac.core.context.ApplicationContext; -//import org.apache.airavata.gfac.core.context.JobExecutionContext; -//import org.apache.airavata.gfac.core.context.MessageContext; -//import org.apache.airavata.gfac.core.cpi.BetterGfacImpl; -//import org.apache.airavata.model.appcatalog.computeresource.*; -//import org.apache.airavata.schemas.gfac.*; -//import org.junit.Assert; -//import org.junit.Before; -//import org.junit.Test; -// -//import java.io.File; -//import java.net.URL; -//import java.util.ArrayList; -//import java.util.List; -// -///** -// * Your Amazon instance should be in a running state before running this test. -// */ -//public class EC2ProviderTest { -// private JobExecutionContext jobExecutionContext; -// -// private static final String hostName = "ec2-host"; -// -// private static final String hostAddress = "ec2-address"; -// -// private static final String sequence1 = "RR042383.21413#CTGGCACGGAGTTAGCCGATCCTTATTCATAAAGTACATGCAAACGGGTATCCATA" + -// "CTCGACTTTATTCCTTTATAAAAGAAGTTTACAACCCATAGGGCAGTCATCCTTCACGCTACTTGGCTGGTTCAGGCCTGCGCCCATTGACCAATATTCCTCA" + -// "CTGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTATCCATCGAAGACTAGGTGGGCCGTTACCCCGC" + -// "CTACTATCTAATGGAACGCATCCCCATCGTCTACCGGAATACCTTTAATCATGTGAACATGCGGACTCATGATGCCATCTTGTATTAATCTTCCTTTCAGAAG" + -// "GCTGTCCAAGAGTAGACGGCAGGTTGGATACGTGTTACTCACCGTGCCGCCGGTCGCCATCAGTCTTAGCAAGCTAAGACCATGCTGCCCCTGACTTGCATGT" + -// "GTTAAGCCTGTAGCTTAGCGTTC"; -// -// private static final String sequence2 = "RR042383.31934#CTGGCACGGAGTTAGCCGATCCTTATTCATAAAGTACATGCAAACGGGTATCCATA" + -// "CCCGACTTTATTCCTTTATAAAAGAAGTTTACAACCCATAGGGCAGTCATCCTTCACGCTACTTGGCTGGTTCAGGCTCTCGCCCATTGACCAATATTCCTCA" + -// "CTGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTATCCATCGAAGACTAGGTGGGCCGTTACCCCGC" + -// "CTACTATCTAATGGAACGCATCCCCATCGTCTACCGGAATACCTTTAATCATGTGAACATGCGGACTCATGATGCCATCTTGTATTAAATCTTCCTTTCAGAA" + -// "GGCTATCCAAGAGTAGACGGCAGGTTGGATACGTGTTACTCACCGTGCG"; -// -// /* Following variables are needed to be set in-order to run the test. Since these are account specific information, -// I'm not adding the values here. It's the responsibility of the person who's running the test to update -// these variables accordingly. -// */ -// -// /* Username used to log into your ec2 instance eg.ec2-user */ -// private String userName = ""; -// -// /* Secret key used to connect to the image */ -// private String secretKey = ""; -// -// /* Access key used to connect to the image */ -// private String accessKey = ""; -// -// /* Instance id of the running instance of your image */ -// private String instanceId = ""; -// -// @Before -// public void setUp() throws Exception { -// URL resource = EC2ProviderTest.class.getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML); -// assert resource != null; -// System.out.println(resource.getFile()); -// GFacConfiguration gFacConfiguration = GFacConfiguration.create(new File(resource.getPath()), null); -// -// /* EC2 Host */ -// ComputeResourceDescription host = new ComputeResourceDescription(); -// host.setHostName(hostName); -// host.setResourceDescription("EC2 compute resource"); -// host.addToIpAddresses(hostAddress); -// -// CloudJobSubmission cloudJobSubmission = new CloudJobSubmission(); -// cloudJobSubmission.setProviderName(ProviderName.EC2); -// cloudJobSubmission.setExecutableType("sh"); -// cloudJobSubmission.setNodeId(instanceId); -// cloudJobSubmission.setSecurityProtocol(SecurityProtocol.USERNAME_PASSWORD); -// cloudJobSubmission.setUserAccountName(userName); -// -// AppCatalog appCatalog = AppCatalogFactory.getAppCatalog(); -// String submissionId = appCatalog.getComputeResource().addCloudJobSubmission(cloudJobSubmission); -// -// JobSubmissionInterface submissionInterface = new JobSubmissionInterface(); -// submissionInterface.setJobSubmissionInterfaceId(submissionId); -// submissionInterface.setJobSubmissionProtocol(JobSubmissionProtocol.CLOUD); -// submissionInterface.setPriorityOrder(0); -// -// host.addToJobSubmissionInterfaces(submissionInterface); -// -// String computeResourceId = appCatalog.getComputeResource().addComputeResource(host); -// -// /* App */ -// -// ApplicationDescription ec2Desc = new ApplicationDescription(Ec2ApplicationDeploymentType.type); -// Ec2ApplicationDeploymentType ec2App = (Ec2ApplicationDeploymentType)ec2Desc.getType(); -// -// String serviceName = "Gnome_distance_calculation_workflow"; -// ec2Desc.getType().addNewApplicationName().setStringValue(serviceName); -// ec2App.setJobType(JobTypeType.EC_2); -// ec2App.setExecutable("/home/ec2-user/run.sh"); -// ec2App.setExecutableType("sh"); -// -// /* Service */ -// ServiceDescription serv = new ServiceDescription(); -// serv.getType().setName("GenomeEC2"); -// -// List<InputParameterType> inputList = new ArrayList<InputParameterType>(); -// -// InputParameterType input1 = InputParameterType.Factory.newInstance(); -// input1.setParameterName("genome_input1"); -// input1.setParameterType(StringParameterType.Factory.newInstance()); -// inputList.add(input1); -// -// InputParameterType input2 = InputParameterType.Factory.newInstance(); -// input2.setParameterName("genome_input2"); -// input2.setParameterType(StringParameterType.Factory.newInstance()); -// inputList.add(input2); -// -// InputParameterType[] inputParamList = inputList.toArray(new InputParameterType[inputList.size()]); -// -// List<OutputParameterType> outputList = new ArrayList<OutputParameterType>(); -// OutputParameterType output = OutputParameterType.Factory.newInstance(); -// output.setParameterName("genome_output"); -// output.setParameterType(StringParameterType.Factory.newInstance()); -// outputList.add(output); -// -// OutputParameterType[] outputParamList = outputList -// .toArray(new OutputParameterType[outputList.size()]); -// -// serv.getType().setInputParametersArray(inputParamList); -// serv.getType().setOutputParametersArray(outputParamList); -// -// jobExecutionContext = new JobExecutionContext(gFacConfiguration,serv.getType().getName()); -// ApplicationContext applicationContext = new ApplicationContext(); -// jobExecutionContext.setApplicationContext(applicationContext); -// applicationContext.setServiceDescription(serv); -// applicationContext.setApplicationDeploymentDescription(ec2Desc); -// applicationContext.setHostDescription(host); -// -// AmazonSecurityContext amazonSecurityContext = -// new AmazonSecurityContext(userName, accessKey, secretKey, instanceId); -// jobExecutionContext.addSecurityContext(AmazonSecurityContext.AMAZON_SECURITY_CONTEXT, amazonSecurityContext); -// -// MessageContext inMessage = new MessageContext(); -// ActualParameter genomeInput1 = new ActualParameter(); -// ((StringParameterType)genomeInput1.getType()).setValue(sequence1); -// inMessage.addParameter("genome_input1", genomeInput1); -// -// ActualParameter genomeInput2 = new ActualParameter(); -// ((StringParameterType)genomeInput2.getType()).setValue(sequence2); -// inMessage.addParameter("genome_input2", genomeInput2); -// -// MessageContext outMessage = new MessageContext(); -// ActualParameter echo_out = new ActualParameter(); -// outMessage.addParameter("distance", echo_out); -// -// jobExecutionContext.setInMessageContext(inMessage); -// jobExecutionContext.setOutMessageContext(outMessage); -// } -// -// @Test -// public void testGramProvider() throws GFacException { -// BetterGfacImpl gFacAPI = new BetterGfacImpl(); -// gFacAPI.submitJob(jobExecutionContext.getExperimentID(), jobExecutionContext.getTaskData().getTaskID(), jobExecutionContext.getGatewayID()); -// MessageContext outMessageContext = jobExecutionContext.getOutMessageContext(); -// Assert.assertEquals(MappingFactory. -// toString((ActualParameter) outMessageContext.getParameter("genome_output")), "476"); -// } -//} -// -//
http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-ec2/src/test/resources/echo.bat ---------------------------------------------------------------------- diff --git a/modules/gfac/gfac-ec2/src/test/resources/echo.bat b/modules/gfac/gfac-ec2/src/test/resources/echo.bat deleted file mode 100644 index c6b849b..0000000 --- a/modules/gfac/gfac-ec2/src/test/resources/echo.bat +++ /dev/null @@ -1,22 +0,0 @@ -:: -:: -:: Licensed to the Apache Software Foundation (ASF) under one -:: or more contributor license agreements. See the NOTICE file -:: distributed with this work for additional information -:: regarding copyright ownership. The ASF licenses this file -:: to you under the Apache License, Version 2.0 (the -:: "License"); you may not use this file except in compliance -:: with the License. You may obtain a copy of the License at -:: -:: http://www.apache.org/licenses/LICENSE-2.0 -:: -:: Unless required by applicable law or agreed to in writing, -:: software distributed under the License is distributed on an -:: "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY -:: KIND, either express or implied. See the License for the -:: specific language governing permissions and limitations -:: under the License. -:: -:: -@echo off -echo %1^=%2 \ No newline at end of file http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-ec2/src/test/resources/logging.properties ---------------------------------------------------------------------- diff --git a/modules/gfac/gfac-ec2/src/test/resources/logging.properties b/modules/gfac/gfac-ec2/src/test/resources/logging.properties deleted file mode 100644 index 0584d38..0000000 --- a/modules/gfac/gfac-ec2/src/test/resources/logging.properties +++ /dev/null @@ -1,42 +0,0 @@ -# -# Licensed to the Apache Software Foundation (ASF) under one -# or more contributor license agreements. See the NOTICE file -# distributed with this work for additional information -# regarding copyright ownership. The ASF licenses this file -# to you under the Apache License, Version 2.0 (the -# "License"); you may not use this file except in compliance -# with the License. You may obtain a copy of the License at -# -# http://www.apache.org/licenses/LICENSE-2.0 -# -# Unless required by applicable law or agreed to in writing, -# software distributed under the License is distributed on an -# "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY -# KIND, either express or implied. See the License for the -# specific language governing permissions and limitations -# under the License. -# -# -#default/fallback log4j configuration -# - -# Set root logger level to WARN and its only appender to A1. -log4j.rootLogger=INFO, A1, A2 - -# A1 is set to be a rolling file appender with default params -log4j.appender.A1=org.apache.log4j.RollingFileAppender -log4j.appender.A1.File=target/seclogs.txt - -# A1 uses PatternLayout. -log4j.appender.A1.layout=org.apache.log4j.PatternLayout -log4j.appender.A1.layout.ConversionPattern=%d [%t] %-5p %c %x - %m%n - -# A2 is a console appender -log4j.appender.A2=org.apache.log4j.ConsoleAppender - -# A2 uses PatternLayout. -log4j.appender.A2.layout=org.apache.log4j.PatternLayout -log4j.appender.A2.layout.ConversionPattern=%d [%t] %-5p %c{1} %x - %m%n - -log4j.logger.unicore.security=INFO - http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-ec2/src/test/resources/service.properties ---------------------------------------------------------------------- diff --git a/modules/gfac/gfac-ec2/src/test/resources/service.properties b/modules/gfac/gfac-ec2/src/test/resources/service.properties deleted file mode 100644 index e266d13..0000000 --- a/modules/gfac/gfac-ec2/src/test/resources/service.properties +++ /dev/null @@ -1,67 +0,0 @@ -# -# -# Licensed to the Apache Software Foundation (ASF) under one -# or more contributor license agreements. See the NOTICE file -# distributed with this work for additional information -# regarding copyright ownership. The ASF licenses this file -# to you under the Apache License, Version 2.0 (the -# "License"); you may not use this file except in compliance -# with the License. You may obtain a copy of the License at -# -# http://www.apache.org/licenses/LICENSE-2.0 -# -# Unless required by applicable law or agreed to in writing, -# software distributed under the License is distributed on an -# "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY -# KIND, either express or implied. See the License for the -# specific language governing permissions and limitations -# under the License. -# -# - -# -# Properties for JCR Registry interface. By default, Apache Jackrabbit is used. -# -# org.apache.jackrabbit.repository.uri=http://localhost:8080/rmi -# jcr.class=org.apache.jackrabbit.rmi.repository.RmiRepositoryFactory -jcr.class=org.apache.jackrabbit.core.RepositoryFactoryImpl -jcr.user=admin -jcr.pass=admin - - -# -# Class which implemented Scheduler interface. It will be used to determine a Provider -# -scheduler.class= org.apache.airavata.core.gfac.scheduler.impl.SchedulerImpl - -# -# Data Service Plugins classes -# -datachain.classes= org.apache.airavata.core.gfac.extension.data.RegistryDataService - -# -# Pre execution Plugins classes. For example, GridFTP Input Staging -# -prechain.classes= org.apache.airavata.core.gfac.extension.pre.GridFtpInputStaging -prechain.classes= org.apache.airavata.core.gfac.extension.pre.HttpInputStaging - -# -# Post execution Plugins classes. For example, GridFTP Output Staging -# -postchain.classes= org.apache.airavata.core.gfac.extension.post.GridFtpOutputStaging -postchain.classes= org.apache.airavata.core.gfac.extension.post.OutputRegister - -# -# SSH private key location. It will be used by SSHProvider -# -# ssh.key=/home/user/.ssh/id_rsa -# ssh.keypass= -# ssh.username=usernameAtHost - -# -# MyProxy credential. It will be used by GridFTP Plugins and GramProvider. -# -# myproxy.server=myproxy.teragrid.org -# myproxy.user=username -# myproxy.pass=password -# myproxy.life=3600 \ No newline at end of file http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-gram/pom.xml ---------------------------------------------------------------------- diff --git a/modules/gfac/gfac-gram/pom.xml b/modules/gfac/gfac-gram/pom.xml deleted file mode 100644 index ac58e15..0000000 --- a/modules/gfac/gfac-gram/pom.xml +++ /dev/null @@ -1,124 +0,0 @@ -<?xml version="1.0" encoding="UTF-8"?> - -<!--Licensed to the Apache Software Foundation (ASF) under one or more contributor license agreements. See the NOTICE file - distributed with this work for additional information regarding copyright ownership. The ASF licenses this file to you under - the Apache License, Version 2.0 (theà "License"); you may not use this file except in compliance with the License. You may - obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to - in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF - ANY ~ KIND, either express or implied. See the License for the specific language governing permissions and limitations under - the License. --> - -<project xmlns="http://maven.apache.org/POM/4.0.0" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://maven.apache.org/POM/4.0.0 http://maven.apache.org/xsd/maven-4.0.0.xsd"> - <parent> - <groupId>org.apache.airavata</groupId> - <artifactId>gfac</artifactId> - <version>0.14-SNAPSHOT</version> - <relativePath>../pom.xml</relativePath> - </parent> - - <modelVersion>4.0.0</modelVersion> - <artifactId>airavata-gfac-gram</artifactId> - <name>Airavata GFac GRAM implementation</name> - <description>This is the extension of GFAC to use GRAM</description> - <url>http://airavata.apache.org/</url> - - <dependencies> - <dependency> - <groupId>org.jglobus</groupId> - <artifactId>gss</artifactId> - <version>${jglobus.version}</version> - </dependency> - <dependency> - <groupId>org.jglobus</groupId> - <artifactId>gram</artifactId> - <version>${jglobus.version}</version> - </dependency> - <dependency> - <groupId>org.jglobus</groupId> - <artifactId>myproxy</artifactId> - <version>${jglobus.version}</version> - </dependency> - <dependency> - <groupId>org.jglobus</groupId> - <artifactId>gridftp</artifactId> - <version>${jglobus.version}</version> - </dependency> - - <!-- Logging --> - <dependency> - <groupId>org.slf4j</groupId> - <artifactId>slf4j-api</artifactId> - </dependency> - - <!-- GFAC schemas --> - <dependency> - <groupId>org.apache.airavata</groupId> - <artifactId>airavata-gfac-core</artifactId> - <version>${project.version}</version> - </dependency> - <!-- Credential Store --> - <dependency> - <groupId>org.apache.airavata</groupId> - <artifactId>airavata-credential-store</artifactId> - <version>${project.version}</version> - </dependency> - <dependency> - <groupId>org.apache.airavata</groupId> - <artifactId>airavata-server-configuration</artifactId> - <scope>test</scope> - </dependency> - <dependency> - <groupId>org.apache.airavata</groupId> - <artifactId>airavata-client-configuration</artifactId> - <scope>test</scope> - </dependency> - - - <!-- Test --> - <dependency> - <groupId>junit</groupId> - <artifactId>junit</artifactId> - <scope>test</scope> - </dependency> - <dependency> - <groupId>org.testng</groupId> - <artifactId>testng</artifactId> - <version>6.1.1</version> - <scope>test</scope> - </dependency> - <dependency> - <groupId>org.slf4j</groupId> - <artifactId>jcl-over-slf4j</artifactId> - <scope>test</scope> - </dependency> - <dependency> - <groupId>org.slf4j</groupId> - <artifactId>slf4j-log4j12</artifactId> - <scope>test</scope> - </dependency> - - <!-- gsi-ssh api dependencies --> - - <dependency> - <groupId>org.apache.airavata</groupId> - <artifactId>airavata-data-models</artifactId> - <version>${project.version}</version> - </dependency> - <dependency> - <groupId>com.jcraft</groupId> - <artifactId>jsch</artifactId> - <version>0.1.50</version> - </dependency> - <dependency> - <groupId>org.ogce</groupId> - <artifactId>bcgss</artifactId> - <version>146</version> - </dependency> - <dependency> - <groupId>org.apache.xmlbeans</groupId> - <artifactId>xmlbeans</artifactId> - <version>${xmlbeans.version}</version> - </dependency> - - </dependencies> -</project> http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/external/GridFtp.java ---------------------------------------------------------------------- diff --git a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/external/GridFtp.java b/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/external/GridFtp.java deleted file mode 100644 index fef9fad..0000000 --- a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/external/GridFtp.java +++ /dev/null @@ -1,558 +0,0 @@ -/* - * - * Licensed to the Apache Software Foundation (ASF) under one - * or more contributor license agreements. See the NOTICE file - * distributed with this work for additional information - * regarding copyright ownership. The ASF licenses this file - * to you under the Apache License, Version 2.0 (the - * "License"); you may not use this file except in compliance - * with the License. You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, - * software distributed under the License is distributed on an - * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY - * KIND, either express or implied. See the License for the - * specific language governing permissions and limitations - * under the License. - * - */ - -package org.apache.airavata.gfac.gram.external; - -import java.io.BufferedReader; -import java.io.File; -import java.io.FileNotFoundException; -import java.io.FileReader; -import java.io.IOException; -import java.io.InputStream; -import java.net.URI; -import java.net.URISyntaxException; -import java.util.ArrayList; -import java.util.Arrays; -import java.util.HashSet; -import java.util.List; -import java.util.Set; -import java.util.Vector; - -import org.apache.airavata.gfac.Constants; -import org.apache.airavata.gfac.GFacException; -import org.apache.airavata.gfac.ToolsException; -import org.apache.airavata.gfac.gram.util.GramProviderUtils; -import org.apache.airavata.gfac.gram.util.GridFTPContactInfo; -import org.globus.ftp.DataChannelAuthentication; -import org.globus.ftp.DataSourceStream; -import org.globus.ftp.FileInfo; -import org.globus.ftp.GridFTPClient; -import org.globus.ftp.HostPort; -import org.globus.ftp.Marker; -import org.globus.ftp.MarkerListener; -import org.globus.ftp.MlsxEntry; -import org.globus.ftp.Session; -import org.globus.ftp.exception.ClientException; -import org.globus.ftp.exception.ServerException; -import org.globus.gsi.gssapi.auth.HostAuthorization; -import org.ietf.jgss.GSSCredential; -import org.slf4j.Logger; -import org.slf4j.LoggerFactory; - -/** - * GridFTP tools - */ -public class GridFtp { - public static final Logger log = LoggerFactory.getLogger(GridFtp.class); - - public static final String GSIFTP_SCHEME = "gsiftp"; - public static final String HOST = "host"; - - /** - * Make directory at remote location - * - * @param destURI - * @param gssCred - * @throws ServerException - * @throws IOException - */ - public void makeDir(URI destURI, GSSCredential gssCred) throws ToolsException { - GridFTPClient destClient = null; - GridFTPContactInfo destHost = new GridFTPContactInfo(destURI.getHost(), destURI.getPort()); - try { - - String destPath = destURI.getPath(); - log.info(("Creating Directory = " + destHost + "=" + destPath)); - - destClient = new GridFTPClient(destHost.hostName, destHost.port); - - int tryCount = 0; - while (true) { - try { - destClient.setAuthorization(new HostAuthorization(GridFtp.HOST)); - destClient.authenticate(gssCred); - destClient.setDataChannelAuthentication(DataChannelAuthentication.SELF); - - if (!destClient.exists(destPath)) { - destClient.makeDir(destPath); - } - break; - } catch (ServerException e) { - tryCount++; - if (tryCount >= 3) { - throw new ToolsException(e.getMessage(), e); - } - Thread.sleep(10000); - } catch (IOException e) { - tryCount++; - if (tryCount >= 3) { - throw new ToolsException(e.getMessage(), e); - } - Thread.sleep(10000); - } - } - } catch (ServerException e) { - throw new ToolsException("Cannot Create GridFTP Client to:" + destHost.toString(), e); - } catch (IOException e) { - throw new ToolsException("Cannot Create GridFTP Client to:" + destHost.toString(), e); - } catch (InterruptedException e) { - throw new ToolsException("Internal Error cannot sleep", e); - } finally { - if (destClient != null) { - try { - destClient.close(); - } catch (Exception e) { - log.warn("Cannot close GridFTP client connection",e); - } - } - } - } - - /** - * Upload file from stream - * - * @param destURI - * @param gsCredential - * @param io - * @throws GFacException - */ - public void uploadFile(URI destURI, GSSCredential gsCredential, InputStream io) throws ToolsException { - GridFTPClient ftpClient = null; - GridFTPContactInfo contactInfo = new GridFTPContactInfo(destURI.getHost(), destURI.getPort()); - - try { - - String remoteFile = destURI.getPath(); - log.info("The remote file is " + remoteFile); - - log.debug("Setup GridFTP Client"); - - ftpClient = new GridFTPClient(contactInfo.hostName, contactInfo.port); - ftpClient.setAuthorization(new HostAuthorization(GridFtp.HOST)); - ftpClient.authenticate(gsCredential); - ftpClient.setDataChannelAuthentication(DataChannelAuthentication.SELF); - - log.info("Uploading file"); - if (checkBinaryExtensions(remoteFile)) { - log.debug("Transfer mode is set to Binary for a file upload"); - ftpClient.setType(Session.TYPE_IMAGE); - } - - ftpClient.put(remoteFile, new DataSourceStream(io), new MarkerListener() { - public void markerArrived(Marker marker) { - } - }); - - log.info("Upload file to:" + remoteFile + " is done"); - - } catch (ServerException e) { - throw new ToolsException("Cannot upload file to GridFTP:" + contactInfo.toString(), e); - } catch (IOException e) { - throw new ToolsException("Cannot upload file to GridFTP:" + contactInfo.toString(), e); - } catch (ClientException e) { - throw new ToolsException("Cannot upload file to GridFTP:" + contactInfo.toString(), e); - } finally { - if (ftpClient != null) { - try { - ftpClient.close(); - } catch (Exception e) { - log.warn("Cannot close GridFTP client connection",e); - } - } - } - } - - public void uploadFile(URI srcURI, URI destURI, GSSCredential gsCredential) throws ToolsException { - GridFTPClient srcClient = null; - GridFTPContactInfo destContactInfo = new GridFTPContactInfo(destURI.getHost(), destURI.getPort()); - GridFTPContactInfo srcContactInfo = new GridFTPContactInfo(srcURI.getHost(),srcURI.getPort()); - try { - String remoteFile = destURI.getPath(); - log.info("The remote file is " + remoteFile); - log.debug("Setup GridFTP Client"); - srcClient = new GridFTPClient(srcContactInfo.hostName, srcContactInfo.port); - srcClient.setAuthorization(new HostAuthorization(GridFtp.HOST)); - srcClient.authenticate(gsCredential); - srcClient.setDataChannelAuthentication(DataChannelAuthentication.SELF); - - GridFTPClient destClient = new GridFTPClient(destContactInfo.hostName, destContactInfo.port); - destClient.setAuthorization(new HostAuthorization(GridFtp.HOST)); - destClient.authenticate(gsCredential); - destClient.setDataChannelAuthentication(DataChannelAuthentication.SELF); - log.debug("Uploading file"); - if (checkBinaryExtensions(remoteFile)) { - log.debug("Transfer mode is set to Binary for a file upload"); - srcClient.setType(Session.TYPE_IMAGE); - } - - srcClient.transfer(srcURI.getPath(),destClient, remoteFile, false, null); - - log.info("Upload file to:" + remoteFile + " is done"); - - } catch (ServerException e) { - throw new ToolsException("Cannot upload file to GridFTP:" + destContactInfo.toString(), e); - } catch (IOException e) { - throw new ToolsException("Cannot upload file to GridFTP:" + destContactInfo.toString(), e); - } catch (ClientException e) { - throw new ToolsException("Cannot upload file to GridFTP:" + destContactInfo.toString(), e); - } finally { - if (srcClient != null) { - try { - srcClient.close(); - } catch (Exception e) { - log.warn("Cannot close GridFTP client connection",e); - } - } - } - } - - /** - * Upload file to remote location - * - * @param destURI - * @param gsCredential - * @param localFile - * @throws GFacException - */ - public void uploadFile(URI destURI, GSSCredential gsCredential, File localFile) throws ToolsException { - GridFTPClient ftpClient = null; - GridFTPContactInfo contactInfo = new GridFTPContactInfo(destURI.getHost(), destURI.getPort()); - try { - - String remoteFile = destURI.getPath(); - - log.info("The local temp file is " + localFile); - log.info("the remote file is " + remoteFile); - - log.debug("Setup GridFTP Client"); - - ftpClient = new GridFTPClient(contactInfo.hostName, contactInfo.port); - ftpClient.setAuthorization(new HostAuthorization(GridFtp.HOST)); - ftpClient.authenticate(gsCredential); - ftpClient.setDataChannelAuthentication(DataChannelAuthentication.SELF); - - log.debug("Uploading file"); - if (checkBinaryExtensions(remoteFile)) { - log.debug("Transfer mode is set to Binary for a file upload"); - ftpClient.setType(Session.TYPE_IMAGE); - } - - - ftpClient.put(localFile, remoteFile, false); - - log.info("Upload file to:" + remoteFile + " is done"); - - } catch (ServerException e) { - throw new ToolsException("Cannot upload file to GridFTP:" + contactInfo.toString(), e); - } catch (IOException e) { - throw new ToolsException("Cannot upload file to GridFTP:" + contactInfo.toString(), e); - } catch (ClientException e) { - throw new ToolsException("Cannot upload file to GridFTP:" + contactInfo.toString(), e); - } finally { - if (ftpClient != null) { - try { - ftpClient.close(); - } catch (Exception e) { - log.warn("Cannot close GridFTP client connection",e); - } - } - } - } - - /** - * Download File from remote location - * - * @param destURI - * @param gsCredential - * @param localFile - * @throws GFacException - */ - public void downloadFile(URI destURI, GSSCredential gsCredential, File localFile) throws ToolsException { - GridFTPClient ftpClient = null; - GridFTPContactInfo contactInfo = new GridFTPContactInfo(destURI.getHost(), destURI.getPort()); - try { - String remoteFile = destURI.getPath(); - - log.info("The local temp file is " + localFile); - log.info("the remote file is " + remoteFile); - - log.debug("Setup GridFTP Client"); - - ftpClient = new GridFTPClient(contactInfo.hostName, contactInfo.port); - ftpClient.setAuthorization(new HostAuthorization(GridFtp.HOST)); - ftpClient.authenticate(gsCredential); - ftpClient.setDataChannelAuthentication(DataChannelAuthentication.SELF); - - log.debug("Downloading file"); - if (checkBinaryExtensions(remoteFile)) { - log.debug("Transfer mode is set to Binary to download a file"); - ftpClient.setType(Session.TYPE_IMAGE); - } - - ftpClient.get(remoteFile, localFile); - - log.info("Download file to:" + localFile + " is done"); - - } catch (ServerException e) { - throw new ToolsException("Cannot download file from GridFTP:" + contactInfo.toString(), e); - } catch (IOException e) { - throw new ToolsException("Cannot download file from GridFTP:" + contactInfo.toString(), e); - } catch (ClientException e) { - throw new ToolsException("Cannot download file from GridFTP:" + contactInfo.toString(), e); - } finally { - if (ftpClient != null) { - try { - //ftpClient.close(); - ftpClient.close(false); - } catch (Exception e) { - log.warn("Cannot close GridFTP client connection",e); - } - } - } - } - - /** - * Stream remote file - * - * @param destURI - * @param gsCredential - * @param localFile - * @return - * @throws GFacException - */ - public String readRemoteFile(URI destURI, GSSCredential gsCredential, File localFile) throws ToolsException { - BufferedReader instream = null; - File localTempfile = null; - try { - - if (localFile == null) { - localTempfile = File.createTempFile("stderr", "err"); - } else { - localTempfile = localFile; - } - - log.info("Local temporary file:" + localTempfile); - - downloadFile(destURI, gsCredential, localTempfile); - - instream = new BufferedReader(new FileReader(localTempfile)); - StringBuffer buff = new StringBuffer(); - String temp = null; - while ((temp = instream.readLine()) != null) { - buff.append(temp); - buff.append(Constants.NEWLINE); - } - - log.info("finish read file:" + localTempfile); - - return buff.toString(); - } catch (FileNotFoundException e) { - throw new ToolsException("Cannot read localfile file:" + localTempfile, e); - } catch (IOException e) { - throw new ToolsException("Cannot read localfile file:" + localTempfile, e); - } finally { - if (instream != null) { - try { - instream.close(); - } catch (Exception e) { - log.warn("Cannot close GridFTP client connection",e); - } - } - } - } - - /** - * Transfer data from one GridFTp Endpoint to another GridFTP Endpoint - * - * @param srchost - * @param desthost - * @param gssCred - * @param srcActive - * @throws ServerException - * @throws ClientException - * @throws IOException - */ - public void transfer(URI srchost, URI desthost, GSSCredential gssCred, boolean srcActive) throws ToolsException { - GridFTPClient destClient = null; - GridFTPClient srcClient = null; - - try { - destClient = new GridFTPClient(desthost.getHost(), desthost.getPort()); - destClient.setAuthorization(new HostAuthorization(GridFtp.HOST)); - destClient.authenticate(gssCred); - - if (checkBinaryExtensions(desthost.getPath())) { - log.debug("Transfer mode is set to Binary"); - destClient.setType(Session.TYPE_IMAGE); - } - - srcClient = new GridFTPClient(srchost.getHost(), srchost.getPort()); - srcClient.setAuthorization(new HostAuthorization(GridFtp.HOST)); - srcClient.authenticate(gssCred); - - if (checkBinaryExtensions(srchost.getPath())) { - log.debug("Transfer mode is set to Binary"); - srcClient.setType(Session.TYPE_IMAGE); - } - - if (srcActive) { - log.debug("Set src active"); - HostPort hp = destClient.setPassive(); - srcClient.setActive(hp); - } else { - log.debug("Set dst active"); - HostPort hp = srcClient.setPassive(); - destClient.setActive(hp); - } - - log.debug("Start transfer file from GridFTP:" + srchost.toString() + " to " + desthost.toString()); - - /** - * Transfer a file. The transfer() function blocks until the transfer is complete. - */ - srcClient.transfer(srchost.getPath(), destClient, desthost.getPath(), false, null); - if (srcClient.getSize(srchost.getPath()) == destClient.getSize(desthost.getPath())) { - log.debug("CHECK SUM OK"); - } else { - log.debug("****CHECK SUM FAILED****"); - } - - } catch (ServerException e) { - throw new ToolsException("Cannot transfer file from GridFTP:" + srchost.toString() + " to " - + desthost.toString(), e); - } catch (IOException e) { - throw new ToolsException("Cannot transfer file from GridFTP:" + srchost.toString() + " to " - + desthost.toString(), e); - } catch (ClientException e) { - throw new ToolsException("Cannot transfer file from GridFTP:" + srchost.toString() + " to " - + desthost.toString(), e); - } finally { - if (destClient != null) { - try { - destClient.close(); - } catch (Exception e) { - log.warn("Cannot close GridFTP client connection at Desitnation:" + desthost.toString()); - } - } - if (srcClient != null) { - try { - srcClient.close(); - } catch (Exception e) { - log.warn("Cannot close GridFTP client connection at Source:" + srchost.toString(),e); - } - } - } - } - - /** - * List files in a GridFTP directory - * @param dirURI - * @param gssCred - * @return - * @throws ToolsException - */ - @SuppressWarnings("unchecked") - public List<String> listDir(URI dirURI, GSSCredential gssCred) throws ToolsException { - List<String> files = new ArrayList<String>(); - GridFTPClient srcClient = null; - try { - GridFTPContactInfo contactInfo = new GridFTPContactInfo(dirURI.getHost(), dirURI.getPort()); - - srcClient = new GridFTPClient(contactInfo.hostName, contactInfo.port); - srcClient.setAuthorization(new HostAuthorization(GridFtp.HOST)); - srcClient.authenticate(gssCred); - srcClient.setDataChannelAuthentication(DataChannelAuthentication.SELF); - srcClient.setType(Session.TYPE_ASCII); - srcClient.changeDir(dirURI.getPath()); - - Vector<Object> fileInfo = null; - try { - fileInfo = srcClient.mlsd(); - } catch (Throwable e) { - fileInfo = srcClient.list(); - } - - if (!fileInfo.isEmpty()) { - for (int j = 0; j < fileInfo.size(); ++j) { - String name = null; - if (fileInfo.get(j) instanceof MlsxEntry) { - name = ((MlsxEntry) fileInfo.get(j)).getFileName(); - } else if (fileInfo.get(j) instanceof FileInfo) { - name = ((FileInfo) fileInfo.get(j)).getName(); - } else { - throw new ToolsException("Unsupported type returned by gridftp " + fileInfo.get(j)); - } - - if (!name.equals(".") && !name.equals("..")) { - URI uri = GramProviderUtils.createGsiftpURI(contactInfo.hostName, dirURI.getPath() + File.separator + name); - files.add(uri.getPath()); - } - } - } - return files; - } catch (IOException e) { - throw new ToolsException("Could not list directory: " + dirURI.toString() ,e); - } catch (ServerException e) { - throw new ToolsException("Could not list directory: " + dirURI.toString() ,e); - } catch (ClientException e) { - throw new ToolsException("Could not list directory: " + dirURI.toString() ,e); - } catch (URISyntaxException e) { - throw new ToolsException("Error creating URL of listed files: " + dirURI.toString() ,e); - } finally { - if (srcClient != null) { - try { - srcClient.close(); - } catch (Exception e) { - log.warn("Cannot close GridFTP client connection", e); - } - } - } - } - /** - * Method to check file extension as binary to set transfer type - * @param filePath - * @return - */ - private static boolean checkBinaryExtensions(String filePath){ - String extension = filePath.substring(filePath.lastIndexOf(".")+1,filePath.length()); - Set<String> extensions = new HashSet<String>(Arrays.asList(new String[] {"tar","zip","gz","tgz"})); - if(extensions.contains(extension)){ - return true; - }else{ - return false; - } - - } - - - - - public String gridFTPFileExist(URI inputDirectory,String fileName,GSSCredential gssCred) throws ToolsException { - List<String> strings = listDir(inputDirectory, gssCred); - for(String fileExist:strings){ - if(fileName.equals(fileExist)) { - fileName = "duplicate_" + fileName; - return fileName; - } - } - return fileName; - } -} http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GramDirectorySetupHandler.java ---------------------------------------------------------------------- diff --git a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GramDirectorySetupHandler.java b/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GramDirectorySetupHandler.java deleted file mode 100644 index f2ccb9a..0000000 --- a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GramDirectorySetupHandler.java +++ /dev/null @@ -1,139 +0,0 @@ -/* - * - * Licensed to the Apache Software Foundation (ASF) under one - * or more contributor license agreements. See the NOTICE file - * distributed with this work for additional information - * regarding copyright ownership. The ASF licenses this file - * to you under the Apache License, Version 2.0 (the - * "License"); you may not use this file except in compliance - * with the License. You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, - * software distributed under the License is distributed on an - * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY - * KIND, either express or implied. See the License for the - * specific language governing permissions and limitations - * under the License. - * -*/ -package org.apache.airavata.gfac.gram.handler; - -import java.net.URI; -import java.net.URISyntaxException; -import java.util.Properties; - -import org.apache.airavata.common.exception.ApplicationSettingsException; -import org.apache.airavata.commons.gfac.type.ApplicationDescription; -import org.apache.airavata.gfac.GFacException; -import org.apache.airavata.gfac.core.context.JobExecutionContext; -import org.apache.airavata.gfac.core.handler.AbstractHandler; -import org.apache.airavata.gfac.core.handler.GFacHandlerException; -import org.apache.airavata.gfac.core.utils.GFacUtils; -import org.apache.airavata.gfac.gram.security.GSISecurityContext; -import org.apache.airavata.gfac.gram.external.GridFtp; -import org.apache.airavata.gfac.gram.util.GramProviderUtils; -import org.apache.airavata.model.workspace.experiment.CorrectiveAction; -import org.apache.airavata.model.workspace.experiment.DataTransferDetails; -import org.apache.airavata.model.workspace.experiment.ErrorCategory; -import org.apache.airavata.model.workspace.experiment.TransferState; -import org.apache.airavata.model.workspace.experiment.TransferStatus; -import org.apache.airavata.registry.cpi.ChildDataType; -import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType; -import org.apache.airavata.schemas.gfac.GlobusHostType; -import org.apache.airavata.schemas.gfac.HostDescriptionType; -import org.apache.airavata.schemas.gfac.UnicoreHostType; -import org.ietf.jgss.GSSCredential; -import org.slf4j.Logger; -import org.slf4j.LoggerFactory; - -public class GramDirectorySetupHandler extends AbstractHandler { - private static final Logger log = LoggerFactory.getLogger(GramDirectorySetupHandler.class); - - public void invoke(JobExecutionContext jobExecutionContext) throws GFacHandlerException { - log.info("Invoking GramDirectorySetupHandler ..."); - super.invoke(jobExecutionContext); - String[] gridFTPEndpointArray = null; - - //TODO: why it is tightly coupled with gridftp -// GlobusHostType host = (GlobusHostType) jobExecutionContext.getApplicationContext().getHostDescription().getType(); - - //TODO: make it more reusable - HostDescriptionType hostType = jobExecutionContext.getApplicationContext().getHostDescription().getType(); - - - - if(hostType instanceof GlobusHostType){ - gridFTPEndpointArray = ((GlobusHostType) hostType).getGridFTPEndPointArray(); - } - else if (hostType instanceof UnicoreHostType){ - gridFTPEndpointArray = ((UnicoreHostType) hostType).getGridFTPEndPointArray(); - } - - - - ApplicationDescription applicationDeploymentDescription = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription(); - ApplicationDeploymentDescriptionType app = applicationDeploymentDescription.getType(); - GridFtp ftp = new GridFtp(); - - try { - - GSSCredential gssCred = ((GSISecurityContext)jobExecutionContext. - getSecurityContext(GSISecurityContext.GSI_SECURITY_CONTEXT)).getGssCredentials(); - - if (gridFTPEndpointArray == null || gridFTPEndpointArray.length == 0) { - gridFTPEndpointArray = new String[]{hostType.getHostAddress()}; - } - boolean success = false; - GFacHandlerException pe = null;// = new ProviderException(""); - for (String endpoint : gridFTPEndpointArray) { - try { - - URI tmpdirURI = GramProviderUtils.createGsiftpURI(endpoint, app.getScratchWorkingDirectory()); - URI workingDirURI = GramProviderUtils.createGsiftpURI(endpoint, app.getStaticWorkingDirectory()); - URI inputURI = GramProviderUtils.createGsiftpURI(endpoint, app.getInputDataDirectory()); - URI outputURI = GramProviderUtils.createGsiftpURI(endpoint, app.getOutputDataDirectory()); - - log.info("Host FTP = " + gridFTPEndpointArray[0]); - log.info("temp directory = " + tmpdirURI); - log.info("Working directory = " + workingDirURI); - log.info("Input directory = " + inputURI); - log.info("Output directory = " + outputURI); - ftp.makeDir(tmpdirURI, gssCred); - ftp.makeDir(workingDirURI, gssCred); - ftp.makeDir(inputURI, gssCred); - ftp.makeDir(outputURI, gssCred); - success = true; - DataTransferDetails detail = new DataTransferDetails(); - TransferStatus status = new TransferStatus(); - status.setTransferState(TransferState.DIRECTORY_SETUP); - detail.setTransferStatus(status); - detail.setTransferDescription("Working directory = " + workingDirURI); - registry.add(ChildDataType.DATA_TRANSFER_DETAIL,detail, jobExecutionContext.getTaskData().getTaskID()); - - break; - } catch (URISyntaxException e) { - pe = new GFacHandlerException("URI is malformatted:" + e.getMessage(), e); - - } catch (Exception e) { - pe = new GFacHandlerException(e.getMessage(), e); - } - } - if (success == false) { - GFacUtils.saveErrorDetails(jobExecutionContext, pe.getLocalizedMessage(), CorrectiveAction.CONTACT_SUPPORT, ErrorCategory.FILE_SYSTEM_FAILURE); - throw pe; - } - } catch (SecurityException e) { - throw new GFacHandlerException(e.getMessage(), e); - } catch (ApplicationSettingsException e1) { - throw new GFacHandlerException(e1.getMessage(), e1); - } catch (GFacException e) { - throw new GFacHandlerException(e); - } - } - - public void initProperties(Properties properties) throws GFacHandlerException { - - } -} http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPInputHandler.java ---------------------------------------------------------------------- diff --git a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPInputHandler.java b/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPInputHandler.java deleted file mode 100644 index ae81357..0000000 --- a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPInputHandler.java +++ /dev/null @@ -1,203 +0,0 @@ -/* - * - * Licensed to the Apache Software Foundation (ASF) under one - * or more contributor license agreements. See the NOTICE file - * distributed with this work for additional information - * regarding copyright ownership. The ASF licenses this file - * to you under the Apache License, Version 2.0 (the - * "License"); you may not use this file except in compliance - * with the License. You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, - * software distributed under the License is distributed on an - * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY - * KIND, either express or implied. See the License for the - * specific language governing permissions and limitations - * under the License. - * -*/ -package org.apache.airavata.gfac.gram.handler; - -import java.io.File; -import java.io.FileInputStream; -import java.io.IOException; -import java.io.InputStream; -import java.net.URI; -import java.net.URISyntaxException; -import java.util.*; - -import org.apache.airavata.common.exception.ApplicationSettingsException; -import org.apache.airavata.common.utils.StringUtil; -import org.apache.airavata.commons.gfac.type.ActualParameter; -import org.apache.airavata.commons.gfac.type.MappingFactory; -import org.apache.airavata.gfac.GFacException; -import org.apache.airavata.gfac.ToolsException; -import org.apache.airavata.gfac.core.context.JobExecutionContext; -import org.apache.airavata.gfac.core.context.MessageContext; -import org.apache.airavata.gfac.core.utils.GFacUtils; -import org.apache.airavata.gfac.gram.security.GSISecurityContext; -import org.apache.airavata.gfac.gram.external.GridFtp; -import org.apache.airavata.gfac.gram.util.GramProviderUtils; -import org.apache.airavata.gfac.core.handler.AbstractHandler; -import org.apache.airavata.gfac.core.handler.AppDescriptorCheckHandler; -import org.apache.airavata.gfac.core.handler.GFacHandlerException; -import org.apache.airavata.model.workspace.experiment.CorrectiveAction; -import org.apache.airavata.model.workspace.experiment.DataTransferDetails; -import org.apache.airavata.model.workspace.experiment.ErrorCategory; -import org.apache.airavata.model.workspace.experiment.TransferState; -import org.apache.airavata.model.workspace.experiment.TransferStatus; -import org.apache.airavata.registry.cpi.ChildDataType; -import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType; -import org.apache.airavata.schemas.gfac.GlobusHostType; -import org.apache.airavata.schemas.gfac.HostDescriptionType; -import org.apache.airavata.schemas.gfac.URIArrayType; -import org.apache.airavata.schemas.gfac.URIParameterType; -import org.apache.airavata.schemas.gfac.UnicoreHostType; -import org.ietf.jgss.GSSCredential; -import org.slf4j.Logger; -import org.slf4j.LoggerFactory; - -public class GridFTPInputHandler extends AbstractHandler { - private static final Logger log = LoggerFactory.getLogger(AppDescriptorCheckHandler.class); - - public void invoke(JobExecutionContext jobExecutionContext) throws GFacHandlerException { - log.info("Invoking GridFTPInputHandler ..."); - super.invoke(jobExecutionContext); - DataTransferDetails detail = new DataTransferDetails(); - TransferStatus status = new TransferStatus(); - - MessageContext inputNew = new MessageContext(); - try { - MessageContext input = jobExecutionContext.getInMessageContext(); - Set<String> parameters = input.getParameters().keySet(); - for (String paramName : parameters) { - ActualParameter actualParameter = (ActualParameter) input.getParameters().get(paramName); - String paramValue = MappingFactory.toString(actualParameter); - //TODO: Review this with type - if ("URI".equals(actualParameter.getType().getType().toString())) { - ((URIParameterType) actualParameter.getType()).setValue(stageInputFiles(jobExecutionContext, paramValue)); - } else if ("URIArray".equals(actualParameter.getType().getType().toString())) { - List<String> split = Arrays.asList(StringUtil.getElementsFromString(paramValue)); - List<String> newFiles = new ArrayList<String>(); - for (String paramValueEach : split) { - String stageInputFiles = stageInputFiles(jobExecutionContext, paramValueEach); - detail.setTransferDescription("Input Data Staged: " + stageInputFiles); - status.setTransferState(TransferState.UPLOAD); - detail.setTransferStatus(status); - registry.add(ChildDataType.DATA_TRANSFER_DETAIL,detail, jobExecutionContext.getTaskData().getTaskID()); - - newFiles.add(stageInputFiles); - } - ((URIArrayType) actualParameter.getType()).setValueArray(newFiles.toArray(new String[newFiles.size()])); - } - inputNew.getParameters().put(paramName, actualParameter); - - } - } catch (Exception e) { - try { - status.setTransferState(TransferState.FAILED); - detail.setTransferStatus(status); - registry.add(ChildDataType.DATA_TRANSFER_DETAIL,detail, jobExecutionContext.getTaskData().getTaskID()); - GFacUtils.saveErrorDetails(jobExecutionContext, e.getLocalizedMessage(), CorrectiveAction.CONTACT_SUPPORT, ErrorCategory.FILE_SYSTEM_FAILURE); - } catch (Exception e1) { - throw new GFacHandlerException("Error persisting status", e1, e1.getLocalizedMessage()); - } - log.error(e.getMessage()); - throw new GFacHandlerException("Error while input File Staging", e, e.getLocalizedMessage()); - } - jobExecutionContext.setInMessageContext(inputNew); - } - - private static String stageInputFiles(JobExecutionContext jobExecutionContext, String paramValue) throws URISyntaxException, SecurityException, ToolsException, IOException,GFacException, ApplicationSettingsException { - URI gridftpURL = new URI(paramValue); - - String[] gridFTPEndpointArray = null; - - // not to download input files to the input dir if its http / gsiftp - // but if local then yes - boolean isInputNonLocal = true; - - //TODO: why it is tightly coupled with gridftp -// GlobusHostType host = (GlobusHostType) jobExecutionContext.getApplicationContext().getHostDescription().getType(); - - //TODO: make it more reusable - HostDescriptionType hostType = jobExecutionContext.getApplicationContext().getHostDescription().getType(); - - if(jobExecutionContext.getApplicationContext().getHostDescription().getType() instanceof GlobusHostType){ - gridFTPEndpointArray = ((GlobusHostType) hostType).getGridFTPEndPointArray(); - } - else if (jobExecutionContext.getApplicationContext().getHostDescription().getType() instanceof UnicoreHostType){ - gridFTPEndpointArray = ((UnicoreHostType) hostType).getGridFTPEndPointArray(); - isInputNonLocal = false; - } - else { - //TODO - } - - - ApplicationDeploymentDescriptionType app = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription().getType(); - GridFtp ftp = new GridFtp(); - URI destURI = null; - GSSCredential gssCred = ((GSISecurityContext)jobExecutionContext.getSecurityContext(GSISecurityContext.GSI_SECURITY_CONTEXT)).getGssCredentials(); - - for (String endpoint : gridFTPEndpointArray) { - URI inputURI = GramProviderUtils.createGsiftpURI(endpoint, app.getInputDataDirectory()); - String fileName = new File(gridftpURL.getPath()).getName(); - fileName = ftp.gridFTPFileExist(inputURI, fileName,gssCred); - - String destLocalPath = inputURI.getPath() + File.separator + fileName; - //if user give a url just to refer an endpoint, not a web resource we are not doing any transfer - if (fileName != null && !"".equals(fileName)) { - destURI = GramProviderUtils.createGsiftpURI(endpoint, destLocalPath); - if (paramValue.startsWith("gsiftp")) { - // no need to do if it is unicore, as unicore will download this on user's behalf to the job space dir - if(isInputNonLocal) ftp.uploadFile(gridftpURL, destURI, gssCred); - else return paramValue; - } else if (paramValue.startsWith("file")) { - String localFile = paramValue.substring(paramValue.indexOf(":") + 1, paramValue.length()); - FileInputStream fis = null; - try { - fis = new FileInputStream(localFile); - ftp.uploadFile(destURI, gssCred, fis); - } catch (IOException e) { - throw new GFacException("Unable to create file : " + localFile ,e); - } finally { - if (fis != null) { - fis.close(); - } - } - } else if (paramValue.startsWith("http")) { - // no need to do if it is unicore - if(isInputNonLocal) { - InputStream is = null; - try { - is = gridftpURL.toURL().openStream(); - ftp.uploadFile(destURI, gssCred, (is)); - }finally { - is.close(); - } - } else { - // don't return destUri - return paramValue; - } - - } else { - //todo throw exception telling unsupported protocol - return paramValue; - } - } else { - // When the given input is not a web resource but a URI type input, then we don't do any transfer just keep the same value as it isin the input - return paramValue; - } - } - return destURI.getPath(); - } - - public void initProperties(Properties properties) throws GFacHandlerException { - - } - - -} http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPOutputHandler.java ---------------------------------------------------------------------- diff --git a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPOutputHandler.java b/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPOutputHandler.java deleted file mode 100644 index 850608f..0000000 --- a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPOutputHandler.java +++ /dev/null @@ -1,343 +0,0 @@ -/* - * - * Licensed to the Apache Software Foundation (ASF) under one - * or more contributor license agreements. See the NOTICE file - * distributed with this work for additional information - * regarding copyright ownership. The ASF licenses this file - * to you under the Apache License, Version 2.0 (the - * "License"); you may not use this file except in compliance - * with the License. You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, - * software distributed under the License is distributed on an - * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY - * KIND, either express or implied. See the License for the - * specific language governing permissions and limitations - * under the License. - * -*/ -package org.apache.airavata.gfac.gram.handler; - -import java.io.BufferedReader; -import java.io.File; -import java.io.FileInputStream; -import java.io.FileNotFoundException; -import java.io.IOException; -import java.io.InputStreamReader; -import java.net.URI; -import java.net.URISyntaxException; -import java.util.*; - -import org.apache.airavata.common.exception.ApplicationSettingsException; -import org.apache.airavata.common.utils.StringUtil; -import org.apache.airavata.commons.gfac.type.ActualParameter; -import org.apache.airavata.commons.gfac.type.ApplicationDescription; -import org.apache.airavata.commons.gfac.type.MappingFactory; -import org.apache.airavata.gfac.GFacException; -import org.apache.airavata.gfac.ToolsException; -import org.apache.airavata.gfac.core.context.JobExecutionContext; -import org.apache.airavata.gfac.core.context.MessageContext; -import org.apache.airavata.gfac.core.handler.AbstractHandler; -import org.apache.airavata.gfac.core.handler.GFacHandlerException; -import org.apache.airavata.gfac.core.provider.GFacProviderException; -import org.apache.airavata.gfac.core.utils.GFacUtils; -import org.apache.airavata.gfac.core.utils.OutputUtils; -import org.apache.airavata.gfac.gram.security.GSISecurityContext; -import org.apache.airavata.gfac.gram.external.GridFtp; -import org.apache.airavata.gfac.gram.util.GramProviderUtils; -import org.apache.airavata.model.appcatalog.appinterface.OutputDataObjectType; -import org.apache.airavata.model.workspace.experiment.CorrectiveAction; -import org.apache.airavata.model.workspace.experiment.DataObjectType; -import org.apache.airavata.model.workspace.experiment.DataTransferDetails; -import org.apache.airavata.model.workspace.experiment.ErrorCategory; -import org.apache.airavata.model.workspace.experiment.TaskDetails; -import org.apache.airavata.model.workspace.experiment.TransferState; -import org.apache.airavata.model.workspace.experiment.TransferStatus; -import org.apache.airavata.registry.cpi.ChildDataType; -import org.apache.airavata.registry.cpi.Registry; -import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType; -import org.apache.airavata.schemas.gfac.GlobusHostType; -import org.apache.airavata.schemas.gfac.HostDescriptionType; -import org.apache.airavata.schemas.gfac.StringArrayType; -import org.apache.airavata.schemas.gfac.URIArrayType; -import org.apache.airavata.schemas.gfac.URIParameterType; -import org.apache.airavata.schemas.gfac.UnicoreHostType; -import org.ietf.jgss.GSSCredential; -import org.slf4j.Logger; -import org.slf4j.LoggerFactory; - - -public class GridFTPOutputHandler extends AbstractHandler { - private static final Logger log = LoggerFactory.getLogger(GridFTPOutputHandler.class); - private Registry registry; - - - public void invoke(JobExecutionContext jobExecutionContext) throws GFacHandlerException { - log.info("Invoking GridFTPOutputHandler ..."); - super.invoke(jobExecutionContext); - - ApplicationDeploymentDescriptionType app = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription().getType(); - - HostDescriptionType hostType = jobExecutionContext.getApplicationContext().getHostDescription().getType(); - String[] gridFTPEndpointArray = null; - String hostName = null; - - if(jobExecutionContext.getApplicationContext().getHostDescription().getType() instanceof GlobusHostType){ - gridFTPEndpointArray = ((GlobusHostType) hostType).getGridFTPEndPointArray(); - hostName = ((GlobusHostType) hostType).getHostName(); - - } - else if (jobExecutionContext.getApplicationContext().getHostDescription().getType() instanceof UnicoreHostType){ - gridFTPEndpointArray = ((UnicoreHostType) hostType).getGridFTPEndPointArray(); - hostName = ((UnicoreHostType) hostType).getHostName(); - } - else { - //TODO - } - - GridFtp ftp = new GridFtp(); - File localStdErrFile = null; - Map<String, ActualParameter> stringMap = new HashMap<String, ActualParameter>(); - DataTransferDetails detail = new DataTransferDetails(); - TransferStatus status = new TransferStatus(); - - try { - GSSCredential gssCred = ((GSISecurityContext)jobExecutionContext.getSecurityContext(GSISecurityContext.GSI_SECURITY_CONTEXT)).getGssCredentials(); - String[] hostgridFTP = gridFTPEndpointArray; - if (hostgridFTP == null || hostgridFTP.length == 0) { - hostgridFTP = new String[]{hostName}; - } - for (String endpoint : gridFTPEndpointArray) { - try { - /* - * Read Stdout and Stderror - */ - URI stdoutURI = GramProviderUtils.createGsiftpURI(endpoint, app.getStandardOutput()); - URI stderrURI = GramProviderUtils.createGsiftpURI(endpoint, app.getStandardError()); - status.setTransferState(TransferState.COMPLETE); - detail.setTransferStatus(status); - detail.setTransferDescription("STDOUT:" + stdoutURI.toString()); - registry.add(ChildDataType.DATA_TRANSFER_DETAIL,detail, jobExecutionContext.getTaskData().getTaskID()); - status.setTransferState(TransferState.COMPLETE); - detail.setTransferStatus(status); - detail.setTransferDescription("STDERR:" + stderrURI.toString()); - registry.add(ChildDataType.DATA_TRANSFER_DETAIL,detail, jobExecutionContext.getTaskData().getTaskID()); - - log.info("STDOUT:" + stdoutURI.toString()); - log.info("STDERR:" + stderrURI.toString()); - - File logDir = new File("./service_logs"); - if (!logDir.exists()) { - logDir.mkdir(); - } - - String timeStampedServiceName = GFacUtils.createUniqueNameWithDate(jobExecutionContext - .getApplicationName()); - File localStdOutFile = File.createTempFile(timeStampedServiceName, "stdout"); - localStdErrFile = File.createTempFile(timeStampedServiceName, "stderr"); - - - String stdout = null; - String stderr = null; - - // TODO: what if job is failed - // and this handler is not able to find std* files? - try { - stdout = ftp.readRemoteFile(stdoutURI, gssCred, localStdOutFile); - stderr = ftp.readRemoteFile(stderrURI, gssCred, localStdErrFile); - //TODO: do we also need to set them as output parameters for another job - ApplicationDescription application = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription(); - ApplicationDeploymentDescriptionType appDesc = application.getType(); - appDesc.setStandardOutput(stdout); - appDesc.setStandardError(stderr); - jobExecutionContext.getApplicationContext().setApplicationDeploymentDescription(application); - } - catch(ToolsException e) { - log.error("Cannot download stdout/err files. One reason could be the job is not successfully finished: "+e.getMessage()); - } - - List<OutputDataObjectType> outputArray = new ArrayList<OutputDataObjectType>(); - Map<String, Object> output = jobExecutionContext.getOutMessageContext().getParameters(); - Set<String> keys = output.keySet(); - for (String paramName : keys) { - ActualParameter actualParameter = (ActualParameter) output.get(paramName); - if ("URIArray".equals(actualParameter.getType().getType().toString())) { - URI outputURI = GramProviderUtils.createGsiftpURI(endpoint, app.getOutputDataDirectory()); - List<String> outputList = ftp.listDir(outputURI, gssCred); - String[] valueList = outputList.toArray(new String[outputList.size()]); - ((URIArrayType) actualParameter.getType()).setValueArray(valueList); - stringMap.put(paramName, actualParameter); - }else if ("StringArray".equals(actualParameter.getType().getType().toString())) { - String[] valueList = OutputUtils.parseStdoutArray(stdout, paramName); - ((StringArrayType) actualParameter.getType()).setValueArray(valueList); - stringMap.put(paramName, actualParameter); - } else if ("URI".equals(actualParameter.getType().getType().toString())) { - URI outputURI = GramProviderUtils.createGsiftpURI(endpoint, app.getOutputDataDirectory()); - List<String> outputList = ftp.listDir(outputURI, gssCred); - if (outputList.size() == 0 || outputList.get(0).isEmpty()) { - OutputUtils.fillOutputFromStdout(output, stdout, stderr,outputArray); - } else { - String valueList = outputList.get(0); - ((URIParameterType) actualParameter.getType()).setValue(valueList); - stringMap = new HashMap<String, ActualParameter>(); - stringMap.put(paramName, actualParameter); - } - } - else { - // This is to handle exception during the output parsing. - OutputUtils.fillOutputFromStdout(output, stdout, stderr,outputArray); - } - status.setTransferState(TransferState.DOWNLOAD); - detail.setTransferStatus(status); - detail.setTransferDescription("Output: " + stringMap.get(paramName).toString()); - registry.add(ChildDataType.DATA_TRANSFER_DETAIL,detail, jobExecutionContext.getTaskData().getTaskID()); - - } - if (outputArray == null || outputArray.isEmpty()) { - throw new GFacHandlerException("Empty Output returned from the Application, Double check the application" + - "and ApplicationDescriptor output Parameter Names"); - } - // If users has given an output Data path to download the output files this will download the file on machine where GFac is installed - TaskDetails taskData = jobExecutionContext.getTaskData(); - if(taskData != null && taskData.getAdvancedOutputDataHandling() != null){ - String outputDataDirectory = taskData.getAdvancedOutputDataHandling().getOutputDataDir(); - if(outputDataDirectory != null && !"".equals(outputDataDirectory)){ - stageOutputFiles(jobExecutionContext,outputDataDirectory); - } - } - } catch (ToolsException e) { - log.error(e.getMessage()); - throw new GFacHandlerException(e.getMessage() + "\n StdError Data: \n" +readLastLinesofStdOut(localStdErrFile.getPath(), 20),e); - } catch (URISyntaxException e) { - log.error(e.getMessage()); - throw new GFacHandlerException("URI is malformatted:" + e.getMessage(), e, readLastLinesofStdOut(localStdErrFile.getPath(), 20)); - } - } - } catch (Exception e) { - try { - status.setTransferState(TransferState.FAILED); - detail.setTransferStatus(status); - registry.add(ChildDataType.DATA_TRANSFER_DETAIL,detail, jobExecutionContext.getTaskData().getTaskID()); - GFacUtils.saveErrorDetails(jobExecutionContext, e.getLocalizedMessage(), CorrectiveAction.CONTACT_SUPPORT, ErrorCategory.FILE_SYSTEM_FAILURE); - } catch (Exception e1) { - throw new GFacHandlerException("Error persisting status", e1, e1.getLocalizedMessage()); - } - log.error(e.getMessage()); - throw new GFacHandlerException(e.getMessage(), e, readLastLinesofStdOut(localStdErrFile.getPath(), 20)); - } - - } - - private static String readLastLinesofStdOut(String path, int count) { - StringBuffer buffer = new StringBuffer(); - FileInputStream in = null; - try { - in = new FileInputStream(path); - } catch (FileNotFoundException e) { - e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates. - } - BufferedReader br = new BufferedReader(new InputStreamReader(in)); - List<String> strLine = new ArrayList<String>(); - String tmp = null; - int numberofLines = 0; - try { - while ((tmp = br.readLine()) != null) { - strLine.add(tmp); - numberofLines++; - } - } catch (IOException e) { - e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates. - } - if (numberofLines > count) { - for (int i = numberofLines - count; i < numberofLines; i++) { - buffer.append(strLine.get(i)); - buffer.append("\n"); - } - } else { - for (int i = 0; i < numberofLines; i++) { - buffer.append(strLine.get(i)); - buffer.append("\n"); - } - } - try { - in.close(); - } catch (IOException e) { - e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates. - } - return buffer.toString(); - } - - private static void stageOutputFiles(JobExecutionContext jobExecutionContext, String outputFileStagingPath) throws GFacProviderException,GFacException, ApplicationSettingsException { - - - HostDescriptionType hostType = jobExecutionContext.getApplicationContext().getHostDescription().getType(); - String[] gridFTPEndpointArray = null; - - if(jobExecutionContext.getApplicationContext().getHostDescription().getType() instanceof GlobusHostType){ - gridFTPEndpointArray = ((GlobusHostType) hostType).getGridFTPEndPointArray(); - } - else if (jobExecutionContext.getApplicationContext().getHostDescription().getType() instanceof UnicoreHostType){ - gridFTPEndpointArray = ((UnicoreHostType) hostType).getGridFTPEndPointArray(); - } - else { - //TODO - } - - - MessageContext outputNew = new MessageContext(); - MessageContext output = jobExecutionContext.getOutMessageContext(); - Map<String, Object> parameters = output.getParameters(); - for (String paramName : parameters.keySet()) { - ActualParameter actualParameter = (ActualParameter) parameters - .get(paramName); - - GridFtp ftp = new GridFtp(); - GSSCredential gssCred = ((GSISecurityContext)jobExecutionContext.getSecurityContext(GSISecurityContext.GSI_SECURITY_CONTEXT)).getGssCredentials(); - try { - if ("URI".equals(actualParameter.getType().getType().toString())) { - for (String endpoint : gridFTPEndpointArray) { - ((URIParameterType) actualParameter.getType()).setValue(doStaging(outputFileStagingPath, - MappingFactory.toString(actualParameter), ftp, gssCred, endpoint)); - } - } else if ("URIArray".equals(actualParameter.getType().getType().toString())) { - List<String> split = Arrays.asList(StringUtil.getElementsFromString(MappingFactory.toString(actualParameter))); - List<String> newFiles = new ArrayList<String>(); - for (String endpoint : gridFTPEndpointArray) { - for (String paramValueEach : split) { - newFiles.add(doStaging(outputFileStagingPath, paramValueEach, ftp, gssCred, endpoint)); - } - ((URIArrayType) actualParameter.getType()).setValueArray(newFiles.toArray(new String[newFiles.size()])); - } - - } - } catch (URISyntaxException e) { - log.error(e.getMessage()); - throw new GFacProviderException(e.getMessage(), e); - } catch (ToolsException e) { - log.error(e.getMessage()); - throw new GFacProviderException(e.getMessage(), e); - } - outputNew.getParameters().put(paramName, actualParameter); - } - jobExecutionContext.setOutMessageContext(outputNew); - } - - private static String doStaging(String outputFileStagingPath, String paramValue, GridFtp ftp, GSSCredential gssCred, String endpoint) throws URISyntaxException, ToolsException { - URI srcURI = GramProviderUtils.createGsiftpURI(endpoint, paramValue); - String fileName = new File(srcURI.getPath()).getName(); - File outputpath = new File(outputFileStagingPath); - if(!outputpath.exists()){ - outputpath.mkdirs(); - } - File outputFile = new File(outputpath.getAbsolutePath() + File.separator + fileName); - ftp.readRemoteFile(srcURI, - gssCred, outputFile); - return outputFileStagingPath + File.separator + fileName; - } - - public void initProperties(Properties properties) throws GFacHandlerException { - - } -} http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/persistence/DBJobPersistenceManager.java ---------------------------------------------------------------------- diff --git a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/persistence/DBJobPersistenceManager.java b/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/persistence/DBJobPersistenceManager.java deleted file mode 100644 index 67ba1a5..0000000 --- a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/persistence/DBJobPersistenceManager.java +++ /dev/null @@ -1,225 +0,0 @@ -/* - * - * Licensed to the Apache Software Foundation (ASF) under one - * or more contributor license agreements. See the NOTICE file - * distributed with this work for additional information - * regarding copyright ownership. The ASF licenses this file - * to you under the Apache License, Version 2.0 (the - * "License"); you may not use this file except in compliance - * with the License. You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, - * software distributed under the License is distributed on an - * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY - * KIND, either express or implied. See the License for the - * specific language governing permissions and limitations - * under the License. - * - */ - -package org.apache.airavata.gfac.gram.persistence; - -import org.apache.airavata.common.utils.DBUtil; -import org.apache.airavata.gfac.GFacException; -import org.apache.airavata.gfac.core.persistence.JobData; -import org.apache.airavata.gfac.core.persistence.JobPersistenceManager; -import org.apache.log4j.Logger; -import org.globus.gram.internal.GRAMConstants; - -import java.sql.Connection; -import java.sql.PreparedStatement; -import java.sql.ResultSet; -import java.sql.SQLException; -import java.util.ArrayList; -import java.util.List; - -/** - * User: AmilaJ ([email protected]) - * Date: 6/18/13 - * Time: 4:16 PM - * Database based job persistence manager. Current default implementation. - */ - -public class DBJobPersistenceManager implements JobPersistenceManager { - - private DBUtil dbUtil; - - private static final Logger log = Logger.getLogger(DBJobPersistenceManager.class); - - - public DBJobPersistenceManager(DBUtil db) { - this.dbUtil = db; - } - - public synchronized void updateJobStatus(JobData jobData) throws GFacException { - - if (jobData.getState() == GRAMConstants.STATUS_UNSUBMITTED) { - insertJob(jobData); - } else { - - String sql = "update gram_job set status = ? where job_id = ?"; - - Connection connection = null; - PreparedStatement stmt = null; - - try { - connection = getConnection(); - stmt = connection.prepareStatement(sql); - stmt.setInt(1, jobData.getState()); - stmt.setString(2, jobData.getJobId()); - - stmt.executeUpdate(); - connection.commit(); - - } catch (SQLException e) { - throw new GFacException(e); - } finally { - try { - if (stmt != null) { - stmt.close(); - } - - if (connection != null) { - connection.close(); - } - - } catch (SQLException e) { - log.error("Error closing streams", e); - } - } - } - } - - private void insertJob(JobData jobData) throws GFacException { - - String sql = "insert into gram_job values (?, ?)"; - - PreparedStatement stmt = null; - Connection connection = null; - - try { - connection = getConnection(); - stmt = connection.prepareStatement(sql); - stmt.setString(1, jobData.getJobId()); - stmt.setInt(2, jobData.getState()); - - stmt.executeUpdate(); - } catch (SQLException e) { - throw new GFacException(e); - } finally { - try { - if (stmt != null) { - stmt.close(); - } - - if (connection != null) { - connection.close(); - } - - } catch (SQLException e) { - log.error("Error closing streams", e); - } - } - - } - - public List<JobData> getRunningJobs() throws GFacException { - - String sql = "select * from gram_job where status not in (?, ?, ?)"; - - int[] statuses = new int[3]; - statuses[0] = GRAMConstants.STATUS_UNSUBMITTED; - statuses[1] = GRAMConstants.STATUS_DONE; - statuses[2] = GRAMConstants.STATUS_FAILED; - - return getJobs(sql, statuses); - } - - public List<JobData> getFailedJobs() throws GFacException { - - String sql = "select * from gram_job where status in (?)"; - - int[] statuses = new int[1]; - statuses[0] = GRAMConstants.STATUS_FAILED; - - return getJobs(sql, statuses); - } - - public List<JobData> getUnSubmittedJobs() throws GFacException { - - String sql = "select * from gram_job where status in (?)"; - - int[] statuses = new int[1]; - statuses[0] = GRAMConstants.STATUS_UNSUBMITTED; - - return getJobs(sql, statuses); - } - - public List<JobData> getSuccessfullyCompletedJobs() throws GFacException { - - String sql = "select * from gram_job where status in (?)"; - - int[] statuses = new int[1]; - statuses[0] = GRAMConstants.STATUS_DONE; - - return getJobs(sql, statuses); - - } - - - protected List<JobData> getJobs(String sql, int[] statuses) throws GFacException { - - List<JobData> jobs = new ArrayList<JobData>(); - - PreparedStatement preparedStatement = null; - Connection connection = null; - - try { - connection = getConnection(); - preparedStatement = connection.prepareStatement(sql); - - int index = 1; - for (int status : statuses) { - preparedStatement.setInt(index, status); - ++index; - } - - ResultSet resultSet = preparedStatement.executeQuery(); - - while (resultSet.next()) { - - String jobId = resultSet.getString("job_id"); - int state = resultSet.getInt("status"); - - jobs.add(new JobData(jobId, state)); - } - - } catch (SQLException e) { - throw new GFacException(e); - } finally { - try { - if (preparedStatement != null) { - preparedStatement.close(); - } - - if (connection != null) { - connection.close(); - } - - } catch (SQLException e) { - log.error("Error closing connection", e); - } - } - - return jobs; - } - - private synchronized Connection getConnection() throws SQLException { - Connection connection = dbUtil.getConnection(); - connection.setAutoCommit(true); - - return connection; - } -}
