Your message dated Fri, 10 Mar 2023 03:34:04 +0000
with message-id <[email protected]>
and subject line Bug#1032550: fixed in igdiscover 0.11-4
has caused the Debian Bug report #1032550,
regarding igdiscover: FTBFS in testing: dh_auto_test: error: pybuild --test 
--test-pytest -i python{version} -p 3.11 returned exit code 13
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact [email protected]
immediately.)


-- 
1032550: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1032550
Debian Bug Tracking System
Contact [email protected] with problems
--- Begin Message ---
Source: igdiscover
Version: 0.11-3
Severity: serious
Justification: FTBFS
Tags: bookworm sid ftbfs
User: [email protected]
Usertags: ftbfs-20230307 ftbfs-bookworm

Hi,

During a rebuild of all packages in testing (bookworm), your package failed
to build on amd64.


Relevant part (hopefully):
> make[1]: Entering directory '/<<PKGBUILDDIR>>'
> dh_auto_build
>       pybuild --build -i python{version} -p 3.11
> I: pybuild base:240: /usr/bin/python3 setup.py build 
> running build
> running build_py
> creating /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/species.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/clonoquery.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/dendrogram.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/rename.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/__main__.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/merge.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/germlinefilter.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/union.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/errorplot.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/plotalleles.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/init.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/group.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/__init__.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/discoverj.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/igblast.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/table.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/config.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/haplotype.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/clonotypes.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/dereplicate.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/upstream.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/commonv.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/discover.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/filter.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/multidiscover.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/run.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/trie.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/clusterplot.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/dbdiff.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/utils.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/_version.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/count.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/cluster.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/parse.py -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/igdiscover.yaml -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/Snakefile -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> copying igdiscover/empty.aux -> 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover
> UPDATING 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover/_version.py
> set 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover/_version.py
>  to '0.11'
> PYTHONPATH=. http_proxy='127.0.0.1:9' sphinx-build -N -bhtml doc/ build/html 
> # HTML generator
> Running Sphinx v5.3.0
> making output directory... done
> WARNING: html_static_path entry '_static' does not exist
> building [mo]: targets for 0 po files that are out of date
> building [html]: targets for 9 source files that are out of date
> updating environment: [new config] 9 added, 0 changed, 0 removed
> reading sources... [ 11%] advanced
> reading sources... [ 22%] changes
> reading sources... [ 33%] develop
> reading sources... [ 44%] faq
> reading sources... [ 55%] guide
> reading sources... [ 66%] index
> reading sources... [ 77%] installation
> reading sources... [ 88%] manual-installation
> reading sources... [100%] testing
> 
> looking for now-outdated files... none found
> pickling environment... done
> checking consistency... done
> preparing documents... done
> writing output... [ 11%] advanced
> writing output... [ 22%] changes
> writing output... [ 33%] develop
> writing output... [ 44%] faq
> writing output... [ 55%] guide
> writing output... [ 66%] index
> writing output... [ 77%] installation
> writing output... [ 88%] manual-installation
> writing output... [100%] testing
> 
> generating indices... genindex done
> writing additional pages... search done
> copying static files... done
> copying extra files... done
> dumping search index in English (code: en)... done
> dumping object inventory... done
> build succeeded, 1 warning.
> 
> The HTML pages are in build/html.
> PYTHONPATH=. http_proxy='127.0.0.1:9' sphinx-build -N -bman  doc/ build/man # 
> Manpage generator
> Running Sphinx v5.3.0
> making output directory... done
> WARNING: html_static_path entry '_static' does not exist
> building [mo]: targets for 0 po files that are out of date
> building [man]: all manpages
> updating environment: [new config] 9 added, 0 changed, 0 removed
> reading sources... [ 11%] advanced
> reading sources... [ 22%] changes
> reading sources... [ 33%] develop
> reading sources... [ 44%] faq
> reading sources... [ 55%] guide
> reading sources... [ 66%] index
> reading sources... [ 77%] installation
> reading sources... [ 88%] manual-installation
> reading sources... [100%] testing
> 
> looking for now-outdated files... none found
> pickling environment... done
> checking consistency... done
> writing... igdiscover.1 { installation manual-installation testing guide faq 
> advanced develop changes } done
> build succeeded, 1 warning.
> 
> The manual pages are in build/man.
> make[1]: Leaving directory '/<<PKGBUILDDIR>>'
>    dh_auto_test -O--buildsystem=pybuild
>       pybuild --test --test-pytest -i python{version} -p 3.11
> I: pybuild base:240: cd 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build; python3.11 -m 
> pytest tests
> ============================= test session starts 
> ==============================
> platform linux -- Python 3.11.2, pytest-7.2.1, pluggy-1.0.0+repack
> rootdir: /<<PKGBUILDDIR>>, configfile: setup.cfg
> collected 36 items
> 
> tests/test_cluster.py ..                                                 [  
> 5%]
> tests/test_commands.py .....                                             [ 
> 19%]
> tests/test_merger.py ............                                        [ 
> 52%]
> tests/test_parse.py .                                                    [ 
> 55%]
> tests/test_species.py FFF                                                [ 
> 63%]
> tests/test_trie.py .....                                                 [ 
> 77%]
> tests/test_utils.py F.......                                             
> [100%]
> 
> =================================== FAILURES 
> ===================================
> __________________________ test_cdr3_detection_heavy 
> ___________________________
> 
>     def test_cdr3_detection_heavy():
>       heavy = """
>       ARRLHSGSYILFDY 
> CAGGTGACCTTGAAGGAGTCTGGTCCTGCGCTGGTGAAACCCACACAGACCCTCACGCTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGTATGGGTGTGGGCTGGATCCGTCAGCCCTCACGGAAGACCCTGGAGTGGCTTGCACACATTTATTGGAATGATGATAAATACTACAGCACATCGCTGAAGAGCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTTCTAACAATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACGGAGACTTCATAGTGGGAGCTACATTCTCTTTGACTACTGGGGCCAGGGAGTCCTGGTCACCGTCTCCTCAGGGAGTGCATCCGCCCCAACCCTTTTCCCCCTCGTCTCCTGTGA
>     
>       ARIKWLRSPGYGYFDF 
> CAGGTGACCTTGAAGGAGTCTGGTCCTGCGCTGGTGAGACCCACACAGACCCTCACTCTGACCTGCACCTTCTCTGGGTTCTCAATCAGCACCTCTGGAACAGGTGTGGGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAATGGCTTGCAAGCATTTATTGGACTGATGCTAAATACTATAGCACATCGCAGAAGAGCAGGCTCACCATCTCCAAGGACACCTCCAGAAACCAGGTGATTCTAACAATGACCAACATGGAGCCTGTGGACATAGCCACATATTTCTGTGCACGGATAAAGTGGCTGCGGTCCCCAGGCTATGGATACTTCGATTTCTGGGGCCCTGGCACCCCAATCACCATCTCCTCAGGGAGTGCATCCGCCCCAACCCTTTTCCCCCTCGTCTCCTGTGA
>     
>       ARHGIAAAGTHNWFDP 
> TCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGGATTACTGTGCGAGACATGGGATAGCAGCAGCTGGTACCCACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGGAGTGCATCCGCCCCAACCCTTTTCCCCCTCGTCTCCTGTGAGAATTCCCCGTCGGCAGGTTGTT
>       """
> >     assert_cdr3_detection('VH', heavy)
> 
> tests/test_species.py:30: 
> _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 
> _ 
> 
> chain = 'VH'
> s = '\n\tARRLHSGSYILFDY 
> CAGGTGACCTTGAAGGAGTCTGGTCCTGCGCTGGTGAAACCCACACAGACCCTCACGCTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGG...ACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGGAGTGCATCCGCCCCAACCCTTTTCCCCCTCGTCTCCTGTGAGAATTCCCCGTCGGCAGGTTGTT\n\t'
> 
>     def assert_cdr3_detection(chain, s):
>       for amino_acids, sequence in split(s):
>               for offset in range(3):
>                       target = sequence[offset:]
>                       match = find_cdr3(target, chain)
> >                     assert match is not None
> E      assert None is not None
> 
> tests/test_species.py:18: AssertionError
> __________________________ test_cdr3_detection_kappa 
> ___________________________
> 
>     def test_cdr3_detection_kappa():
>       kappa = """
>     QQYDSSPRT 
> TTCAGTGGCAGTGGAGCAGGGACAGATTTCACTCTCACCATCAGCAGTCTGGAACCTGAGGATGTCGCAACTTACTACTGTCAGCAGTATGATAGCAGCCCCCGGACGTTCGGCGCTGGGACCAAGCTGGAAATCAAACGGAGTGTGCAGAAGCCAACTATCTCCCTCTTCCCTCCATCATCTGAGGAGG
>     
>     QQYSSYPYT 
> GAGCTGGCCTCGGGAGTCCCAGCTCGCTTCAGTGGGAGTGGGTCAGGGACTTCTTTCTCTCTCACAATCAGCAACGTGGAGGCTGAAGATGTTGCAACCTATTACTGTCAGCAGTATAGCAGTTATCCGTACACGTTCGGCGCAGGGACCAAGCTGGAAATCAAACGGAGTGTGCAGAAGCCAACTATCTCCCTCTTCCCTCCATCATCTGAGGAGG
>     
>     LQYDSSPYT 
> ATTCTCACCATCAGCAGCCTGCAGCCTGAAGACTTTGCAACTTACTACTGTCTACAGTATGATAGTTCCCCGTACACGTTCGGCGCAGGGACCAAGCTGGAAATCAAACGGAGTGTGCAGAAGCCAACTATCTCCCTCTTCCCTCCATCATCTGAGGAGG
>     
>     FQYYSGRLT 
> ACAGACTTCACTCTCACCATCAGCAGCCTGCAGCCTGAGGACATTGCAGTTTATTACTGTTTCCAGTATTACAGCGGGAGACTCACGTTCGGAGGAGGGACCCGCTTGGAAATCAAACGGAGTGTGCAGAAGCCAACTATCTCCCTCTTCCCTCCATCATCTGAGGAGG
>       """
> >     assert_cdr3_detection('VK', kappa)
> 
> tests/test_species.py:43: 
> _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 
> _ 
> 
> chain = 'VK'
> s = '\nQQYDSSPRT 
> TTCAGTGGCAGTGGAGCAGGGACAGATTTCACTCTCACCATCAGCAGTCTGGAACCTGAGGATGTCGCAACTTACTACTGTCAGCAGTATGATAGCAGCCCCCGG...ACTGTTTCCAGTATTACAGCGGGAGACTCACGTTCGGAGGAGGGACCCGCTTGGAAATCAAACGGAGTGTGCAGAAGCCAACTATCTCCCTCTTCCCTCCATCATCTGAGGAGG\n\t'
> 
>     def assert_cdr3_detection(chain, s):
>       for amino_acids, sequence in split(s):
>               for offset in range(3):
>                       target = sequence[offset:]
>                       match = find_cdr3(target, chain)
> >                     assert match is not None
> E      assert None is not None
> 
> tests/test_species.py:18: AssertionError
> __________________________ test_cdr3_detection_lambda 
> __________________________
> 
>     def test_cdr3_detection_lambda():
>       lambda_ = """
>     LTYHGNSGTFV 
> GGATCCAAAAACCCCTCAGCCAATGCAGGAATTTTGCTCATCTCTGAACTCCAGAATGAGGATGAGGCTGACTATTACTGTCTGACATATCATGGTAATAGTGGTACTTTTGTATTCGGTGGAGGAACCAAGCTGACCGTCCTAGGTCAGCCCAAGTCTGCCCCCACAGTCAGCCTGTTCC
>     
>     QLWDANSTV 
> ATGGCCACACTGACCATCACTGGCGCCCAGGGTGAGGACGAGGCCGACTATTGCTGTCAGTTGTGGGATGCTAACAGTACTGTGTTCGGTGGAGGAACCACGCTGACCGTCCTAGGTCAGCCCAAGTCTGCCCCCACAGTCAGCCTGTTCCCGCCCTCCTC
>     
>     GVGYSGGYV 
> GATCGCTACTTAACCATCTCCAACATCCAGCCTGAAGACGAGGCTGACTATTTCTGTGGTGTGGGTTATAGCGGTGGTTATGTATTCGGTGGAGGAACCAAGTTGACCGTCCTAGGTCAGCCCAAGTCTGCTCCCACAGTCAGCCTGTTCCCGCCCTCCTC
>       """
> >     assert_cdr3_detection('VL', lambda_)
> 
> tests/test_species.py:54: 
> _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 
> _ 
> 
> chain = 'VL'
> s = '\nLTYHGNSGTFV 
> GGATCCAAAAACCCCTCAGCCAATGCAGGAATTTTGCTCATCTCTGAACTCCAGAATGAGGATGAGGCTGACTATTACTGTCTGACATATCATGGTAATAGTG...CTATTTCTGTGGTGTGGGTTATAGCGGTGGTTATGTATTCGGTGGAGGAACCAAGTTGACCGTCCTAGGTCAGCCCAAGTCTGCTCCCACAGTCAGCCTGTTCCCGCCCTCCTC\n\t'
> 
>     def assert_cdr3_detection(chain, s):
>       for amino_acids, sequence in split(s):
>               for offset in range(3):
>                       target = sequence[offset:]
>                       match = find_cdr3(target, chain)
> >                     assert match is not None
> E      assert None is not None
> 
> tests/test_species.py:18: AssertionError
> ________________________________ test_has_stop 
> _________________________________
> 
>     def test_has_stop():
> >     assert has_stop('TAA')
> E    AssertionError: assert False
> E     +  where False = has_stop('TAA')
> 
> tests/test_utils.py:11: AssertionError
> =============================== warnings summary 
> ===============================
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_commands.py::test_main
>   /usr/lib/python3/dist-packages/snakemake/rules.py:14: DeprecationWarning: 
> module 'sre_constants' is deprecated
>     import sre_constants
> 
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_merger.py::TestPrefixDict::test_ambiguous
>   /usr/lib/python3/dist-packages/_pytest/fixtures.py:901: 
> PytestRemovedIn8Warning: Support for nose tests is deprecated and will be 
> removed in a future release.
>   
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_merger.py::TestPrefixDict::test_ambiguous
>  is using nose-specific method: `setup(self)`
>   To remove this warning, rename it to `setup_method(self)`
>   See docs: 
> https://docs.pytest.org/en/stable/deprecations.html#support-for-tests-written-for-nose
>     fixture_result = next(generator)
> 
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_merger.py::TestPrefixDict::test_missing
>   /usr/lib/python3/dist-packages/_pytest/fixtures.py:901: 
> PytestRemovedIn8Warning: Support for nose tests is deprecated and will be 
> removed in a future release.
>   
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_merger.py::TestPrefixDict::test_missing
>  is using nose-specific method: `setup(self)`
>   To remove this warning, rename it to `setup_method(self)`
>   See docs: 
> https://docs.pytest.org/en/stable/deprecations.html#support-for-tests-written-for-nose
>     fixture_result = next(generator)
> 
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_merger.py::TestPrefixDict::test_existing
>   /usr/lib/python3/dist-packages/_pytest/fixtures.py:901: 
> PytestRemovedIn8Warning: Support for nose tests is deprecated and will be 
> removed in a future release.
>   
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_merger.py::TestPrefixDict::test_existing
>  is using nose-specific method: `setup(self)`
>   To remove this warning, rename it to `setup_method(self)`
>   See docs: 
> https://docs.pytest.org/en/stable/deprecations.html#support-for-tests-written-for-nose
>     fixture_result = next(generator)
> 
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_empty_string
>   /usr/lib/python3/dist-packages/_pytest/fixtures.py:901: 
> PytestRemovedIn8Warning: Support for nose tests is deprecated and will be 
> removed in a future release.
>   
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_empty_string
>  is using nose-specific method: `setup(self)`
>   To remove this warning, rename it to `setup_method(self)`
>   See docs: 
> https://docs.pytest.org/en/stable/deprecations.html#support-for-tests-written-for-nose
>     fixture_result = next(generator)
> 
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_contains
>   /usr/lib/python3/dist-packages/_pytest/fixtures.py:901: 
> PytestRemovedIn8Warning: Support for nose tests is deprecated and will be 
> removed in a future release.
>   
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_contains
>  is using nose-specific method: `setup(self)`
>   To remove this warning, rename it to `setup_method(self)`
>   See docs: 
> https://docs.pytest.org/en/stable/deprecations.html#support-for-tests-written-for-nose
>     fixture_result = next(generator)
> 
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_len
>   /usr/lib/python3/dist-packages/_pytest/fixtures.py:901: 
> PytestRemovedIn8Warning: Support for nose tests is deprecated and will be 
> removed in a future release.
>   
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_len
>  is using nose-specific method: `setup(self)`
>   To remove this warning, rename it to `setup_method(self)`
>   See docs: 
> https://docs.pytest.org/en/stable/deprecations.html#support-for-tests-written-for-nose
>     fixture_result = next(generator)
> 
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_has_similar
>   /usr/lib/python3/dist-packages/_pytest/fixtures.py:901: 
> PytestRemovedIn8Warning: Support for nose tests is deprecated and will be 
> removed in a future release.
>   
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_has_similar
>  is using nose-specific method: `setup(self)`
>   To remove this warning, rename it to `setup_method(self)`
>   See docs: 
> https://docs.pytest.org/en/stable/deprecations.html#support-for-tests-written-for-nose
>     fixture_result = next(generator)
> 
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_find_all_similar
>   /usr/lib/python3/dist-packages/_pytest/fixtures.py:901: 
> PytestRemovedIn8Warning: Support for nose tests is deprecated and will be 
> removed in a future release.
>   
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_trie.py::TestTrie::test_find_all_similar
>  is using nose-specific method: `setup(self)`
>   To remove this warning, rename it to `setup_method(self)`
>   See docs: 
> https://docs.pytest.org/en/stable/deprecations.html#support-for-tests-written-for-nose
>     fixture_result = next(generator)
> 
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_utils.py::test_config
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_utils.py::test_config
>   
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build/igdiscover/config.py:82:
>  PendingDeprecationWarning: 
>   safe_load will be removed, use
>   
>     yaml=YAML(typ='safe', pure=True)
>     yaml.load(...)
>   
>   instead
>     new_config = self.make_compatible(ruamel.yaml.safe_load(content))
> 
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_utils.py::test_config
> .pybuild/cpython3_3.11_igdiscover/build/tests/test_utils.py::test_config
>   /usr/lib/python3/dist-packages/ruamel/yaml/main.py:1123: 
> PendingDeprecationWarning: 
>   load will be removed, use
>   
>     yaml=YAML(typ='unsafe', pure=True)
>     yaml.load(...)
>   
>   instead
>     return load(stream, SafeLoader, version)
> 
> -- Docs: https://docs.pytest.org/en/stable/how-to/capture-warnings.html
> =========================== short test summary info 
> ============================
> FAILED tests/test_species.py::test_cdr3_detection_heavy - assert None is not 
> ...
> FAILED tests/test_species.py::test_cdr3_detection_kappa - assert None is not 
> ...
> FAILED tests/test_species.py::test_cdr3_detection_lambda - assert None is 
> not...
> FAILED tests/test_utils.py::test_has_stop - AssertionError: assert False
> ================== 4 failed, 32 passed, 13 warnings in 3.40s 
> ===================
> E: pybuild pybuild:388: test: plugin distutils failed with: exit code=1: cd 
> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_igdiscover/build; python3.11 -m 
> pytest tests
> dh_auto_test: error: pybuild --test --test-pytest -i python{version} -p 3.11 
> returned exit code 13


The full build log is available from:
http://qa-logs.debian.net/2023/03/07/igdiscover_0.11-3_testing.log

All bugs filed during this archive rebuild are listed at:
https://bugs.debian.org/cgi-bin/pkgreport.cgi?tag=ftbfs-20230307;[email protected]
or:
https://udd.debian.org/bugs/?release=na&merged=ign&fnewerval=7&flastmodval=7&fusertag=only&fusertagtag=ftbfs-20230307&[email protected]&allbugs=1&cseverity=1&ctags=1&caffected=1#results

A list of current common problems and possible solutions is available at
http://wiki.debian.org/qa.debian.org/FTBFS . You're welcome to contribute!

If you reassign this bug to another package, please mark it as 'affects'-ing
this package. See https://www.debian.org/Bugs/server-control#affects

If you fail to reproduce this, please provide a build log and diff it with mine
so that we can identify if something relevant changed in the meantime.

--- End Message ---
--- Begin Message ---
Source: igdiscover
Source-Version: 0.11-4
Done: Nilesh Patra <[email protected]>

We believe that the bug you reported is fixed in the latest version of
igdiscover, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to [email protected],
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Nilesh Patra <[email protected]> (supplier of updated igdiscover package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing [email protected])


-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA256

Format: 1.8
Date: Fri, 10 Mar 2023 08:28:12 +0530
Source: igdiscover
Architecture: source
Version: 0.11-4
Distribution: unstable
Urgency: medium
Maintainer: Debian Med Packaging Team 
<[email protected]>
Changed-By: Nilesh Patra <[email protected]>
Closes: 977067 1032550
Changes:
 igdiscover (0.11-4) unstable; urgency=medium
 .
   * Team Upload.
   * Add patch to fix flaky tests (Closes: #1032550, #977067)
Checksums-Sha1:
 b622ae3c49a7d2a88793edd777f36ae039bd89fe 1707 igdiscover_0.11-4.dsc
 3928c1251dc42a06862a4f41c23629e4fd44f499 4696 igdiscover_0.11-4.debian.tar.xz
 16a03aaec8e6aeca7ee3c18a88e0544c100f067e 12979 
igdiscover_0.11-4_amd64.buildinfo
Checksums-Sha256:
 a8e1780774554828dcc72080fc1cfb3e492934d669ff218562c18cbea5a0b78f 1707 
igdiscover_0.11-4.dsc
 bd6ccc583476197f09830f8fd14b1f054c88327de05164bf7a46d0360c2bc6aa 4696 
igdiscover_0.11-4.debian.tar.xz
 a706c390cfac38f7dc2a91dbb18b0cb1de001b18158453201508f03e249e5777 12979 
igdiscover_0.11-4_amd64.buildinfo
Files:
 1aa49f317d2b1f813931c3a4ad3d19f6 1707 science optional igdiscover_0.11-4.dsc
 1bd19cbc4699a02db1c7c94d46861fa3 4696 science optional 
igdiscover_0.11-4.debian.tar.xz
 833ebb737b98012deae8e09a37ba332d 12979 science optional 
igdiscover_0.11-4_amd64.buildinfo

-----BEGIN PGP SIGNATURE-----

iHUEARYIAB0WIQSglbZu4JAkvuai8HIqJ5BL1yQ+2gUCZAqgRgAKCRAqJ5BL1yQ+
2k4FAQDn1J8oOHhNgSJ+fQ4FMVFp20pJ9kV1d+HU23uDUV+A7gEA96R834n+UZHS
QqiVq5oDCoyzN/Z/ph+4xZlxL9/P0wk=
=W8Jr
-----END PGP SIGNATURE-----

--- End Message ---

Reply via email to