Nilesh Patra pushed to branch master at Debian Med / nanosv
Commits: 48726de4 by Nilesh Patra at 2021-05-29T21:08:59+05:30 Since toy.sam is available in the samtools package already, simply take the relevant file from there - - - - - 3c875e17 by Nilesh Patra at 2021-05-29T21:10:39+05:30 Add recommends on sambamba - - - - - ace8e110 by Nilesh Patra at 2021-05-29T21:10:43+05:30 Update Interim changelog entry - - - - - 7 changed files: - debian/README.test - debian/changelog - debian/control - debian/copyright - − debian/examples - − debian/tests/data/read.sam - debian/tests/run-unit-test Changes: ===================================== debian/README.test ===================================== @@ -9,7 +9,3 @@ in order to confirm its integrity. Notes on the files used for testing ──────────────────────────────────────── -Files: debian/tests/data/* -Source: https://github.com/samtools/samtools/blob/develop/examples/toy.sam - - ===================================== debian/changelog ===================================== @@ -1,8 +1,7 @@ nanosv (1.2.4+git20190409.c1ae30c-4) UNRELEASED; urgency=medium - * Add test data + * Team Upload. * Add autopkgtests - * Add examples and docs -- Shruti Sridhar <[email protected]> Wed, 26 May 2021 17:09:51 +0530 ===================================== debian/control ===================================== @@ -18,6 +18,7 @@ Rules-Requires-Root: no Package: nanosv Architecture: all +Recommends: sambamba Depends: ${python3:Depends}, ${misc:Depends}, python3-pysam, ===================================== debian/copyright ===================================== @@ -10,10 +10,6 @@ Files: debian/* Copyright: 2020 Steffen Moeller <[email protected]> License: MIT -Files: debian/tests/data/* -Copyright: 2008-2020 Genome Research Ltd. -License : MIT - License: MIT Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), ===================================== debian/examples deleted ===================================== @@ -1 +0,0 @@ -debian/tests/data/* \ No newline at end of file ===================================== debian/tests/data/read.sam deleted ===================================== @@ -1,14 +0,0 @@ -@SQ SN:ref LN:45 -@SQ SN:ref2 LN:40 -r001 163 ref 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 -r002 0 ref 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * -r003 0 ref 9 30 5H6M * 0 0 AGCTAA * -r004 0 ref 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * -r003 16 ref 29 30 6H5M * 0 0 TAGGC * -r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT * -x1 0 ref2 1 30 20M * 0 0 aggttttataaaacaaataa ???????????????????? -x2 0 ref2 2 30 21M * 0 0 ggttttataaaacaaataatt ????????????????????? -x3 0 ref2 6 30 9M4I13M * 0 0 ttataaaacAAATaattaagtctaca ?????????????????????????? -x4 0 ref2 10 30 25M * 0 0 CaaaTaattaagtctacagagcaac ????????????????????????? -x5 0 ref2 12 30 24M * 0 0 aaTaattaagtctacagagcaact ???????????????????????? -x6 0 ref2 14 30 23M * 0 0 Taattaagtctacagagcaacta ??????????????????????? \ No newline at end of file ===================================== debian/tests/run-unit-test ===================================== @@ -2,6 +2,7 @@ set -e pkg=nanosv +examplepkg=samtools export LC_ALL=C.UTF-8 if [ "${AUTOPKGTEST_TMP}" = "" ] ; then @@ -9,18 +10,17 @@ if [ "${AUTOPKGTEST_TMP}" = "" ] ; then trap "rm -rf ${AUTOPKGTEST_TMP}" 0 INT QUIT ABRT PIPE TERM fi -cp -a /usr/share/doc/${pkg}/examples/* "${AUTOPKGTEST_TMP}" +cp -a /usr/share/doc/${examplepkg}/examples/toy.sam "${AUTOPKGTEST_TMP}" cd "${AUTOPKGTEST_TMP}" +mv -f toy.sam read.sam cat read.sam| samtools view -Sb > reads.bam samtools sort reads.bam > reads_sort.bam samtools index reads_sort.bam reads_sort.bai bedtools bamtobed -i reads_sort.bam > target.bed -NanoSV reads_sort.bam -b target.bed -s sambamba -o output.vcf -[ -s "output.vcf" ] || exit 1 && echo "PASS Test" - #Output generated is not consistent and cannot be compared with a reference. - - \ No newline at end of file +NanoSV reads_sort.bam -b target.bed -s sambamba -o output.vcf +[ -s "output.vcf" ] || exit 1 +echo "PASS Test" View it on GitLab: https://salsa.debian.org/med-team/nanosv/-/compare/a0c6fe0a2d2402755e55659a12e88a885771b908...ace8e1103ee955bd8002e22c6275f3ae77d05286 -- View it on GitLab: https://salsa.debian.org/med-team/nanosv/-/compare/a0c6fe0a2d2402755e55659a12e88a885771b908...ace8e1103ee955bd8002e22c6275f3ae77d05286 You're receiving this email because of your account on salsa.debian.org.
_______________________________________________ debian-med-commit mailing list [email protected] https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
