On 17/06/21 03:45 PM, Aaron M. Ucko wrote: > Nilesh Patra <nil...@nileshpatra.info> writes: > > > Since fetching it directly from a file location or a sort of API doesn't > > seem the way out, writing a script directly looks not easy. > > Programmatic retrieval is very much possible, via ncbi-entrez-direct: > > $ efetch -db nuccore -id CP014688.1 -format fasta | head -n175 > >CP014688.1 Acetobacter persici strain TMW2.1084 plasmid pAC1084_1, > complete sequence > ACGAGGTCGTTTCTGTCGACCCGCTGGCTATATTCAGGCTGGTAGATGTCGGCGTGGTCTGATTATTACC > [...] > > or, with a slightly different defline, ncbi-tools-bin: > > $ idfetch -t5 -s 'gb|CP014688.1' | head -n175 > >gi|1149544201|gb|CP014688.1| Acetobacter persici strain TMW2.1084 > ACGAGGTCGTTTCTGTCGACCCGCTGGCTATATTCAGGCTGGTAGATGTCGGCGTGGTCTGATTATTACC > [...]
I didn't know about this, thank you tons for the help! :-) Just added in a script for getting data > That said, pre-retrieval does have the advantage of letting the tests > work offline. Absolutely! Nilesh
signature.asc
Description: PGP signature