On 8/23/17 5:53 AM, biocyberman wrote:
I lost my momentum to learn D and want to gain it up again. Therefore I need some help with this seemingly simple task:

# Fasta sequence


\>Entry1_ID header field1|header field2|...
CAGATATCTTTGATGTCCTGATTGGAAGGACCGTTGGCCCCCCACCCTTAGGCAG
TGTATACTCTTCCATAAACGAGCTATTAGTTATGAGGTCCGTAGATTGAAAAGGG
TGACGGAATTCGGCCGAACGGGAAAGACGGACATCTAGGTATCCTGAGCACGGTT
GCGCGTCCGTATCAAGCTCCTCTTTATAGGCCCCG
\>Entry2_ID header field1|header field4|...
GTTACTGTTGGTCGTAGAGCCCAGAACGGGTTGGGCAGATGTACGACAATATCGCT
TAGTCACCCTTGGGCCACGGTCCGCTACCTTACAGGAATTGAGA

\>Entry3_ID header field1|header field2|...
GGCAGTACGATCGCACGCCCCACGTGAACGATTGGTAAACCCTGTGGCCTGTGAGC
GACAAAAGCTTTAATGGGAAATACGCGCCCATAACTTGGTGCGA

# Some characteristics:

- Entry_ID is >[[:alphanumeric:]]. Where '>' marks the entry start. In this post I have to put an escape character (\) to make the '>' visible. - Headers may contain annotation information separated by some delimiter (i.e. | in this case). - Entry ID and header is a single line, which does not contain newline characters.
- Sequence under the header line is [ATCGN\n]* (Perl regex).
- A fasta file can be plain-text or gzip compressed.


# Goals:
Write a parser that uses Dlang range with iopipe library for performance and ease of use. A big fasta file can be dozens of gigabytes.

# Questions:

1. How do I model a fasta entry with a struct or class?
2. How to I implement a range of fasta entries with iopipe. A range in this case can be a forward range, but preferably a random access range. 3. I want to do with range to explore the power and elegance of ranges. But if performance is a big concern, what can I do alternatively?

I'll respond to all your questions with what I would do, instead of answering each one.

I would suggest an approach similar to how I approached parsing JSON data. In your case, the protocol is even simpler, as there is no nesting.

1. The base layer iopipe should be something that tokenizes the input into reference-based structs. If you look at the jsoniopipe library (https://github.com/schveiguy/jsoniopipe), you can see that the lowest level finds the start of the next JSON token. In your case, it should be looking for >[[:alphanumeric:]] (or possibly just >).

This code is pretty straightforward, and roughly corresponds to this:
while(cannot find start sequence in stream)
    stream.extend;
make sure you aren't re-doing work that has already been done (i.e. save the last place you looked).

Once you have this, you can deduce each packet by the data between the starts.

2. The next layer should validate and parse the data into structs that contain referencing data from the buffer. I recommend not using actual ranges from the buffer, but information on how to build the ranges. The reason for this is that the buffer can move while being streamed by iopipe, so your data could become invalid if you take actual references to the buffer. If you look in the jsoniopipe library, the struct for storing a json item has a start and length, but not a reference to the buffer.

Potentially, you could take this mechanism and build an iopipe on top of the buffered data. This iopipe's elements would be the items themselves, with the underlying buffer hidden in the implementation details. Extending would parse out another set of items, releasing would allow those items to get reclaimed (and the underlying stream data).

This is something I actually wanted to explore with jsoniopipe but didn't have time before the conference. I probably will still build it.

3. build your real code on top of that layer. What do you want to do with the data? Easiest thing to do for proof of concept is build a range out of the functions. That can allow you to test performance with your lower layers. One of the awesome things about iopipe is testing correctness is really easy -- every string is also an iopipe :)

I actually worked with a person at dconf on a similar (maybe identical?) format and explained how it could be done in a very similar way. He was looking to remove data that had a low percentage of correctness (or something like that, not in bioinformatics, so I don't understand the real semantics).

With this mechanism in hand, the decompression is pretty easy to chain together with whatever actual stream you have, just use iopipe.zip.

Good luck, and email me if you need more help ([email protected]).

-Steve

Reply via email to