Hi, I tried a repetition with fuzznuc in a pattern. It seems that when I start a range with 0 e.g. (0,1), the pattern is not found when it is located at the end of the sequence and the count of the character is 0. This only occurs when there are more matches possible.
The following example shows this. It contains the pattern, once with 4 mismatches. >test ACTACTACATACATACACATATACACATGAGGTTTTAGGGGATGACGTAAGGGGGNNNNNGAGGAAGGAGGGGATGACGT fuzznuc -pmismatch 4 -sequence test.fa -outfile test.fuzznuc -pattern 'GAGGAAGGAGGGGATGACGT' results in the expected output: Start End Strand Pattern Mismatch Sequence 29 48 + pattern:GAGGAAGGAGGGGATGACGT 4 GAGGTTTTAGGGGATGACGT 61 80 + pattern:GAGGAAGGAGGGGATGACGT . GAGGAAGGAGGGGATGACGT However, fuzznuc -pmismatch 4 -sequence test.fa -outfile test.fuzznuc -pattern 'GAGGAAGGAGGGGATGACGTn(0,3)' only find the first pattern at pos 29, with 0,1,2 and 3 times a match any nucleotide (so 4 matches in total), but not the one at 61-80. Now, if I request 0 mismatches (-pmismatch 0), then this last pattern is reported (from 61 to 80). When requesting e.g. 3 mismatches no hit is found. The first has 4 mismatches, but now also also last with 0 mismatches is not reported. This only seems to be reported when I ask for 0 mismatches. However, when allowing 4 mismatches I'd expect 5 hits in total (4 starting at 29 with 4 mismatches) and one starting at 61. This occured in EMBOSS 6.3.1 and 6.5.7. Is this a wrong expectation, or is something not going entirely right? Kind regards, Bernd _______________________________________________ EMBOSS mailing list EMBOSS@lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/emboss