Hi All, I downloaded some RNA-seq datasets from NCBI. The datasets were generated by Illumina Hiseq 2000. I am not sure which "Input FASTQ quality scores type" I should choose when run FASTQ Groomer. Below shows the scores of 2 reads of a dataset, I renamed them as "read 1" and "read 2".
1) Sequence and quality score displayed in Galaxy @read 1 length=51 NTGAGATTCTTGACTAGTTATTTCTGCTTTCAGGGAAGAAATCAGCTGGGC +read 1 length=51 #1=ADADEHHHHHIIGIHJGJJJHJIIJJJH@HEGBFH;FHEH>@HIJJJJ @read 2 length=51 NGAAGAGTCAGTTTTTTGTTTCCCTCATAACTTGCTAGATTCCGGATTGCT +read 2 length=51 #1=DDDEDHHFHHJJJJJIJJHIIIJJJIJJJJJJJIJIJJJJJJIJJJJI 2) Sequence and one chanel quality score shown in SRA of NCBI when I downloaded the dataset. >gnl|SRA|read 1 NTGAGATTCTTGACTAGTTATTTCTGCTTTCAGGGAAGAAATCAGCTGGGC One channel quality score 2 16 28 32 35 32 35 36 39 39 39 39 39 40 40 38 40 39 41 38 41 41 41 39 41 40 40 41 41 41 39 31 39 36 38 33 37 39 26 37 39 36 39 29 31 39 40 41 41 41 41 >gnl|SRA|read 2 NGAAGAGTCAGTTTTTTGTTTCCCTCATAACTTGCTAGATTCCGGATTGCT One channel quality score 2 16 28 35 35 35 36 35 39 39 37 39 39 41 41 41 41 41 40 41 41 39 40 40 40 41 41 41 40 41 41 41 41 41 41 41 40 41 40 41 41 41 41 41 41 40 41 41 41 41 40 Looks like the dataset is generated by illumina that is later than version 1.8 because some of the reads are at score quality of 41. Can I choose "sanger" as "Input FASTQ quality scores type" when I run FASTQ Groomer? Thanks. Jianguang Du
___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
