Good Morning Andreas:
Watch out for the - strand coordinates.
The start and end coordinates of this sequence is found via:
157194 = 225932-(68705+33)
157227 = 225932-68705
Then, reverse compliment your result as so:
$ twoBitToFa -start=157194 -end=157227 -seq=scaffold_2538 dasNov2.2bit stdout \
| faRc -keepCase stdin stdout
>RC_scaffold_2538:157194-157227
ATCTACTCTTTTACCCATCCCTCCAAAAAGCCT
--Hiram
Andreas Gruber wrote:
> Hi
>
> I am having problems matching a sequence listed in a MAF alignment (hg18
> 44way multiz) back to the genome of the species. I have this line from
> the Armadillo in the alignment:
> s dasNov2.scaffold_2538 68705 33 - 225932
> ATCTACTC----------T-TTTACCCATCCCTCCAAAAAGCCT
>
> I have obtained the dasNov2 genome assembly from
> ftp://hgdownload.cse.ucsc.edu/gbdb/dasNov2/dasNov2.2bit and converted it
> back to fasta using the utilities from the BLAT suite.
>
> When I try to extract the particular sequence now using fastacmd, I end
> up with a sequence containing just Ns.
> fastacmd -d dasNov2.fa -s scaffold_2538 -L 68705,68738 -S2
> >lcl|scaffold_2538:68705-68738 No definition line found
> NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
>
> Any ideas what went wrong?
>
> Cheers,
> Andreas
>
_______________________________________________
Genome maillist - [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome
