Hello Xinxia,
The position is the chrom:chromStart-chromEnd for this rangeSubstitution SNP.
You have come across one of those dbSNP entries that have the data a bit mixed
up. UCSC only reports the SNP data - we do not create it. However, we do try to
add in some annotation to help when there is a conflict. Too see all possible
annotations, open the mouse mm9 browser, click into the track description, and
scroll to "UCSC Annotations". To see the annotations assigned to any SNP, you
can search by rs number in the browser and click on the feature to see the data
description - UCSC's annotations are at the end of the header section, right
before the flanking sequence alignments. For downloaded data, the table
snp128Exceptions also contains the annotations.
For this SNP the data displayed in the browser is (note the annotation at the
end):
Simple Nucleotide Polymorphisms (dbSNP build 128)
dbSNP build 128 rs32449302
dbSNP: rs32449302
Position: chr1:25165767-25165835
Band: 1qA5
Genomic Size: 69
View DNA for this feature
Strand: +
Observed: A/G
Reference allele:
AAAACAAAACAAAGCAAAACAAAAGAGACAAACAAACAACAACCCCAAATTATGTTGGTGTGTAAAAAA
Class: single
Validation: unknown
Function: intron
Molecule Type: genomic
Weight: 1
Annotations:
NCBI's alignment of the flanking sequences had at least one mismatch or gap.
(UCSC's re-alignment of flanking sequences to the genome may be informative --
see below.)
All observed alleles are single-base, but the annotation spans more than 1
base. (UCSC's re-alignment of flanking sequences to the genome may be
informative -- see below.)
UCSC reference allele does not match any observed allele from dbSNP.
Jennifer
------------------------------------------------
Jennifer Jackson
UCSC Genome Bioinformatics Group
----- "Xinxia Peng" <[email protected]> wrote:
> From: "Xinxia Peng" <[email protected]>
> To: "[email protected]" <[email protected]>
> Sent: Friday, February 5, 2010 11:41:42 AM GMT -08:00 US/Canada Pacific
> Subject: [Genome] SNP base position?
>
> Hi,
>
> I downloaded 'snp128' table for 'mm9' (the first two lines shown
> below). Where is the base position for the SNP?
>
> #bin chrom chromStart chromEnd name score strand
> refNCBI refUCSC observed molType class valid avHet
> avHetSE func locType weight
> 1 chr1 25165766 25165835 rs32449302 0
> +
> AAAACAAAACAAAGCAAAACAAAAGAGACAAACAAACAACAACCCCAAATTATGTTGGTGTGTAAAAAA
> AAAACAAAACAAAGCAAAACAAAAGAGACAAACAAACAACAACCCCAAATTATGTTGGTGTGTAAAAAA
> A/G genomic single unknown 0 0 intron
> rangeSubstitution 1
>
> Thanks,
> Xinxia
>
>
> _______________________________________________
> Genome maillist - [email protected]
> https://lists.soe.ucsc.edu/mailman/listinfo/genome
_______________________________________________
Genome maillist - [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome
