Hello Pierre, We have determined that the data as originally incorporated into the track was strangely annotated and Ensembl has since corrected the error. The track on our side will be updated (and this data corrected) at the next update. Updates for this track occur for all active databases through a staged process, at intervals linked to Ensembl releases. Once this track update occurs for hg18, the error will correct itself.
We cannot state today when exactly this update will occur for hg18, but if you still notice the problem after a month or so and want an update, feel free to write back to see if we have an estimated updated track release date at that time. Thank you for reporting the problem! Jennifer --------------------------------- Jennifer Jackson UCSC Genome Informatics Group http://genome.ucsc.edu/ On 5/25/10 4:29 PM, Antonio Coelho wrote: > Hello Pierre, > That is certainly not expected behavior. On investigation, it seems > to be a problem on our side. We'll investigate and try to resolve it as > soon as possible. > > Thanks for bringing it to our attention. > > Antonio Coelho > UCSC Genome Bioinformatics Group > > Pierre Lindenbaum wrote: >> Hi UCSC, >> I've noticed that some records in hg18/ensGene have a cDNA where the >> length is not a multiple of 3. >> For example in >> http://genome.ucsc.edu/cgi-bin/hgc?g=htcGeneMrna&i=ENST00000383614&c=chr6&l=30082338&r=30083996&o=ensGene&table=ensGene >> <http://genome.ucsc.edu/cgi-bin/hgc?g=htcGeneMrna&i=ENST00000383614&c=chr6&l=30082338&r=30083996&o=ensGene&table=ensGene> >> >> |>ENST00000383614 >> ccccagacgccgacgatggggtcATGGCGCCCCGAACCCTCCTCCTGCTG >> CTCTCGGGGACCCTGGCCCTGGCCGAGACCTGGGCGGCCCCCCCCAAGAC >> ACACGTGACCCacccccctctctgaacatgaggcataa >> | >> >> | echo-n >> ATGGCGCCCCGAACCCTCCTCCTGCTGCTCTCGGGGACCCTGGCCCTGGCCGAGACCTGGGCGGCCCCCCCCAAGACACACGTGACCC| >> wc-c >> 88 >> >> is it me, a bug from ensembl, a bug from UCSC or am I missing something ? :-) >> >> >> Thanks ! >> | >> >> >> Pierre Lindenbaum >> >> _______________________________________________ >> Genome maillist - [email protected] >> https://lists.soe.ucsc.edu/mailman/listinfo/genome >> > > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
