We don't use process substitution. We know nothing about how it works. You can read the BLAT source.
I will send the author Jim Kent a short note about your question. -Galt 6/8/2010 10:44 AM, Peng Yu: > I try to use process substitution (basically,<(cmd) in bash). But it > doesn't work for blat. See below for the comparsion between with > process substitution and without. > > Could you please let me know why it is not working for blat? > > $ cat query.fasta >> test_sequence > cttgcaccggaaagtctgctccaga > $ cat database.fasta >> chr1 > cttgcaccggaaagtctgctccaga > $ make > blat -t=dna -q=dna -minScore=25 -maxGap=0 \ > database.fasta \ > query.fasta \ > query.psl > Loaded 25 letters in 1 sequences > Searched 25 bases in 1 sequences > blat -t=dna -q=dna -minScore=25 -maxGap=0 \ > <(cat database.fasta) \ > <(cat query.fasta) \ > query1.psl > Loaded 0 letters in 0 sequences > Searched 0 bases in 0 sequences > $ cat query.psl > psLayout version 3 > > match mis- rep. N's Q gap Q gap T gap T gap strand Q > Q Q > Q T T T T block blockSizes > qStarts tStarts > match match count bases count bases > name > size start end name size start end count > --------------------------------------------------------------------------------------------------------------------------------------------------------------- > 25 0 0 0 0 0 0 0 + > test_sequence 25 0 25 chr1 25 0 25 1 > 25, 0, 0, > $ cat query1.psl > psLayout version 3 > > match mis- rep. N's Q gap Q gap T gap T gap strand Q > Q Q > Q T T T T block blockSizes > qStarts tStarts > match match count bases count bases > name > size start end name size start end count > --------------------------------------------------------------------------------------------------------------------------------------------------------------- > > _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
