Hi again,
I'm having another problem with BLAT:
The following 50bp read maps without mismatches across a splice junction:
TAGCCCTAGTGTAGAGAAATACAGGTATCAGGATGAAGATACACCTCCTC

However, only the part mapping to one exon maps with BLAT, and the part from 
the other exon is not mapping, even though it is a perfect match.

This is true in both the web-based BLAT and the command-line with the same 
parameters. How should I alter BLAT's parameters so it is able to map the 
entire length of such a read?

Thanks.

 

 


_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to