Hi again, I'm having another problem with BLAT: The following 50bp read maps without mismatches across a splice junction: TAGCCCTAGTGTAGAGAAATACAGGTATCAGGATGAAGATACACCTCCTC
However, only the part mapping to one exon maps with BLAT, and the part from the other exon is not mapping, even though it is a perfect match. This is true in both the web-based BLAT and the command-line with the same parameters. How should I alter BLAT's parameters so it is able to map the entire length of such a read? Thanks. _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
