Hi James,

Unfortunately, this is not an option as the output from the Get DNA 
button is always formatted in FASTA format, which does not contain line 
numbers. More information about the FASTA format can be found here: 
http://en.wikipedia.org/wiki/FASTA_format.

I hope this information is helpful.  Please feel free to contact the 
mail list again if you require further assistance.

Best,
Mary
------------------
Mary Goldman
UCSC Bioinformatics Group

On 9/10/10 4:26 PM, James Charles *Darwin* Widdoes wrote:
> How do I display line numbers when displaying DNA sequences?
>
> For example, when I ask for the DNA sequences for chr1:10,001-20,000 I
> receive
>
>    
>> hg19_dna range=chr1:10001-20000 5'pad=0 3'pad=0 strand=+
>>      
> repeatMasking=none
> taaccctaaccctaaccctaaccctaaccctaaccctaaccctaacccta
> accctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaac
> cctaacccaaccctaaccctaaccctaaccctaaccctaaccctaacccc
> taaccctaaccctaaccctaaccctaacctaaccctaaccctaaccctaa
> ccctaaccctaaccctaaccctaaccctaacccctaaccctaaccctaaa
> ...
> ...
> ...
> aggggcagtgggagggaactgagactggggagggacaaaggctgctctgt
>
>
> I would like to get
>
>    
>> hg19_dna range=chr1:10001-20000 5'pad=0 3'pad=0 strand=+
>>      
> repeatMasking=none
> 202 taaccctaaccctaaccctaaccctaaccctaaccctaaccctaacccta
> 203 accctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaac
> 204 cctaacccaaccctaaccctaaccctaaccctaaccctaaccctaacccc
> 205 taaccctaaccctaaccctaaccctaacctaaccctaaccctaaccctaa
> 206 ccctaaccctaaccctaaccctaaccctaacccctaaccctaaccctaaa
> ...
> ...
> ...
> 401 aggggcagtgggagggaactgagactggggagggacaaaggctgctctgt
>
> Can you tell me how to get line numbers in the display?
>
> J Charles 'Darwin' Widdoes  www.lava.net/~brainy  www.eskimo.com/~brainy
>
> _______________________________________________
> Genome maillist  -  [email protected]
> https://lists.soe.ucsc.edu/mailman/listinfo/genome
>    
_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to