Hi, Adriana What genome are you using? hg19?
You can try runing blat on the forward and reverse primers individually. Sometimes you have to check the flip reverse primer checkbox. -Galt On 05/18/11 13:07, Pitea Adriana wrote: Hi everyone, I would like to know what ways are to check the results after using In-Silico PCR tool http://genome.ucsc.edu/cgi-bin/hgPcr and entered some primers. For example: Forward: AGAAGTCGGAATCGTGGGCC Reverse: AAACAGCTGAGCTGATTGGC I Thank you. Adriana > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
