On 23.11.11 23:04, Pauline Fujita wrote: > Hello Carsten, > > Yes, that is correct. Note that a much better resource for help with > samtools and SAM is the samtools-help mailing list: > https://lists.sourceforge.net/lists/listinfo/samtools-help > > Also, http://samtools.sourceforge.net/ has a link to the specification > for SAM/BAM which explains all columns including the numeric flag column. > > Best regards, > > Pauline Fujita > UCSC Genome Bioinformatics Group > http://genome.ucsc.edu > > > On 11/23/11 11:42 AM, Carsten Raabe wrote: >> dear all, >> >> I do have question regarding the BAM alignment files specified above. I >> converted the BAM file into the SAM file using SAM tools, however I am >> not clear which field holds the orientation of the match (read) with >> regards to the genome. Would the 16 and 0 in column 2 stand for reverse >> and direct orientation respectively?? >> >> >> Thanks a lot in advance, >> >> Carsten >> _______________________________________________ >> Genome maillist [email protected] >> https://lists.soe.ucsc.edu/mailman/listinfo/genome > Dear Pauline, dear all,
I am afraid I am still not getting it correctly. According to what I have read and explained in last mail I would expect that Flag 16 in column2 stands for reverse matching (*>>>* i.e. the RNA is encoded on the reverse strand). In the examples below I challenged the annotation within the sam file by blating the read against the human genome. Interestingly there is no difference in orientation of the read irrespective of the column2 Flag (>>> 16 or 0). Would that mean that the sequence in the sam file irrespective of true read annotation always resembles the sense strand ?? If correct this would make me conclude that the coordinate in column4 in case of Flag 16 stands for the 3' most position of the read. Thanks a lot in advance..... Carsten 9990-80 *16* chr11 *59394452* 255 41M * 0 0 AGTTGCCCTACGTGTGCCACTCACGACAGAAGCCCTTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:41 NM:i:0 YG :i:1 YC:Z:255,0,255 *>>>> UCSC browser* 9990-80 41 1 41 41 100.0% 11 *+ 59394452* 59394492 41 9994-80 *16* chr2 *133012312 * 255 34M * 0 0 TGGCTGAACGCCACTTGTCCCTCTAAGAAGTTGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:34 NM:i:0 YG:i:1 YC:Z:255,0 ,255 *>>>> UCSC browser* 9994-80 34 1 34 34 100.0% 2 *+* *133012312* 133012345 34 9999-80 *0 * chr13 *92003326 * 255 25M * 0 0 TAAAGTGCTTATAGTGCAGGTAATT IIIIIIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:22G1G0 NM:i:2 YG:i:1 YC:Z:255,0,255 *>>> UCSC browser* 9999-80 22 1 22 25 100.0% 13 *+* *92003326* 92003347 22 9990-80 *16* chr11 *59394452* 255 41M * 0 0 AGTTGCCCTACGTGTGCCACTCACGACAGAAGCCCTTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:41 NM:i:0 YG :i:1 YC:Z:255,0,255 *>>>> UCSC browser* 9990-80 41 1 41 41 100.0% 11*+* *59394452* 59394492 41 9965-80 *0 * chr13 *92002872* 255 23M * 0 0 CAAAGTGCNTACAGTGCAGGTAG IIIIIIIIIIIIIIIIIIIIIII XA:i:1 MD:Z:8T14 NM:i:1 YG:i:1 YC:Z:255,0,255 *>>>> UCSC browser *9965-80 22 1 23 23 100.0% 13 *+* *92002872* 92002894 23 _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
