Hi I have a question regarding BLAT on command line and BLAT on web browser.

I am getting different results when I run the same query sequence in the 
following way:


1.       Query sequence run in command line BLAT  against hg18 2 bit format

blat -stepSize=5 -repMatch=2253 -minScore=0 -minIdentity=0 
~/Projects/Tandem_Repeats/NS_SNP_assoc/BLAT_results_Real_NanostringData/SNP_Genotype/All_Pop_Seperate/Correlation/Correlation_Results_Summary/OTHERS/Human.2bit
 /home/brahmm01/Projects/BLAT/Query_Sequence.txt Results_blat_hg18.psl





2.        Query sequence run in command line BLAT  against only chr14 in 2 bit 
format ( I am considering only chr 14 as the hits on this chromosome are of my 
prime interest)

blat -stepSize=5 -repMatch=2253 -minScore=0 -minIdentity=0 
~/Projects/Tandem_Repeats/NS_SNP_assoc/BLAT_results_Real_NanostringData/SNP_Genotype/All_Pop_Seperate/Correlation/Correlation_Results_Summary/OTHERS/chr14.2bit
 /home/brahmm01/Projects/BLAT/Query_Sequence.txt 
/home/brahmm01/Projects/BLAT/Query_blat_chr14.psl



3.       Query sequence run in command line BLAT  against only chr14 in 2 bit 
format with output format as blast output

4.       blat -stepSize=5 -repMatch=2253 -minScore=0 -minIdentity=0 
/home/brahmm01/Projects/BLAT/chr14.2bit 
/home/brahmm01/Projects/BLAT/Query_Sequence.txt out=blast8 
/home/brahmm01/Projects/BLAT/Results_blat_chr14.blast.txt

5.       Query sequence run on the web browser



I am not sure why I am getting different results in terms of the start and end 
positions of the target region.



Manisha


























Manisha Brahmachary,
Department of Genetics and Genomic Sciences
Prof. Andrew J. SHARP laboratory
Mount Sinai School of Medicine
Icahn Medical Institute, Room L14-02
1425 Madison Avenue, Box 1498
NY-10029, NEW-YORK, USA
Email:[email protected]

>cg19008523
CTCCCAGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTACAGGCATGCGCCACCACGCCCAGCTAATTTTGTATTTTTAATAGAGAGAGGGTTTCTCCATGTTGGTCAG
_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to