Hello, Cong Liu,
If I understand your question, you have the DNA sequences of probes and are
using blat to align them to the reference assembly? You would like to
see them
all at once?
If so, then you can create a custom PSL track with the blat output in a
few steps.
At the blat input page, select
Output type: psl no header.
When you input your probes, you should follow the instructions on the
blat input
page. Briefly, limit your input to 25 sequences at a time and include a
header line
for each probe, e.g.:
> probe1
ACTGCTGTCATGAGCCCTGGTGGTTTTAAAGGAAAAGTTGGTGGCCGGGT
> probe2
GTGGTGGTTTGTGCCTGTAATCCCACCACTTTGGGAGGCCAAGGCGGGTG
You can upload them in a file.
After submitting your sequence, copy the output to a file and add a
Custom Track
header to the PSL output. At minimum, the header should be
track name="my probes"
[you probably want to add: visibility=pack so you can see the label in the
track]
Then, back at the Browser graphic page, go to "add (or manage) custom
tracks."
You can either copy/paste or upload the saved file to create your track.
Good luck in your work. Thanks for using the Genome Browser.
best wishes,
--b0b kuhn
ucsc genome bioinformatics group
On 1/18/2012 2:13 PM, Cong Liu wrote:
> I want to view multiple (eg. 25) probes (60 mer) aligned in genome browser
> together. How do I do it? At this point, I am able to load them in one batch,
> but results show each of them separately.
>
> Thanks.
> _______________________________________________
> Genome maillist - [email protected]
> https://lists.soe.ucsc.edu/mailman/listinfo/genome
_______________________________________________
Genome maillist - [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome
