Hi Vidya, The sequence is from the negative strand which is what is likely causing you confusion. Please see the following previously answered mailing list question: https://lists.soe.ucsc.edu/pipermail/genome/2009-June/019359.html
If you need reverse-complemented sequence, another way to get it would be from the "Get DNA" link. From the main Genome Browser page (http://genome.ucsc.edu/cgi-bin/hgTracks), hit the "DNA" link in the blue bar at the top of the page. It will default to the forward strand. You can use the "extended case/color options" to highlight the result. If you have further questions, please email the list: [email protected]. Vanessa Kirkup Swing UCSC Genome Bioinformatics Group ---------- Forwarded message ---------- From: Vidya .H.K <[email protected]> Date: Tue, May 15, 2012 at 1:25 AM Subject: [Genome] doubt regarding sequence retrieval To: [email protected] Hi, This is Vidya, Jr research Associate. I have a doubt regarding the sequence retrieval of a gene. e.g. I want the sequence for chromosome 1: 179846800 to 179847000, when I am giving the gene name, the coordinates given by UCSC is 179809102 to 179846941. This sequence has 59 nucleotides less at the end when compared to my query. Please suggest me whether I should add the nucleotides by checking promoter/upstream checkbox or downstream checkbox? When I check on the upstream checkbox, the nucleotides are added in the beginning of the sequence but the position number changes at the end. why is it so? Below I am giving the sequences retrieved; 1.Original gene sequence >hg19_knownGene_uc001gnl.3 range=chr1:179809102-179846941 5'pad=0 3'pad=0 strand=- repeatMasking=none GACATTCGGGCCGCGGCGGCCGCTGGGTGCAGCCGAGCGGTGTGGAGCGG AGAGAATACTCGAAGGGCTCTCCTGATACTAACAGTTTTACGATTTAAAA CTTCGCCAGAATTTgtaagtaaacaaaatgactatgcagcttttccatgt tttagtattgaaactgatatcttgaatttttgaaaaggactttcagaaac ggtccctccccacccccaccttcgtaccgcacaaatggtatttttatttt 2. Sequence got when I checked upstream checkbox with addition of 59 nucleotides. >hg19_knownGene_uc001gnl.3 range=chr1:179809102-179847000 5'pad=0 3'pad=0 strand=- repeatMasking=none aggattccacgggcgccttccggcggaaagtgtttgtcatatgggcgggg accctggacGACATTCGGGCCGCGGCGGCCGCTGGGTGCAGCCGAGCGGT GTGGAGCGGAGAGAATACTCGAAGGGCTCTCCTGATACTAACAGTTTTAC GATTTAAAACTTCGCCAGAATTTgtaagtaaacaaaatgactatgcagct tttccatgttttagtattgaaactgatatcttgaatttttgaaaaggact Please resolve the problem for which I would be grateful. Regards H.K.VIDYA PGDB-10-10-33 ----------------------------------------- Institute of Bioinformatics and Applied Biotechnology, Bangalore _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
