Yes, I had the same problem sometime ago as well. It seem to occur randomly! Aris
On 6/18/07, David Withers <[EMAIL PROTECTED]> wrote:
When I send the following query http://www.biomart.org:/biomart/martservice?query= <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE Query> <Query virtualSchemaName="default" count="0" softwareVersion="0.5" requestId="taverna"> <Dataset name="rnorvegicus_gene_ensembl"> <Attribute name="gene_stable_id" /> <Attribute name="coding_gene_flank" /> <Filter name="ensembl_gene_id" value="ENSRNOG00000028302" /> <Filter name="upstream_flank" value="100" /> </Dataset> </Query> I get the result CTCCCGGCCTCCGTTCCTTTCGGTCCGACGCGCCTCGGCCCCGCCCCAGCCCACCGGATTCTTTCCAGCTCGACCCCGGCTGCCAGTTTCCCCCGCCGCC ENSRNOG00000028302 I was expecting the gene id to be the first result as it's the first attribute in the query. David. -- David Withers School of Computer Science, University of Manchester, Oxford Road, Manchester, M13 9PL, UK. Tel: +44(0)161 275 0145
