> And now for something completely different ... I'm looking for an image of a 
> DNA strand that's quite long and that I can manipulate.

Here’s my suggestion. If you make up a Fasta file, Open Babel can generate XYZ 
coordinates, e.g.

>DNA
GATTACAGATTACAGATTACA

So that’s, say “dna.fasta”

babel dna.fasta dna.xyz

OK, now you have the normal double-helix. So you want to manipulate it. My 
suggestion, naturally, is to use Avogadro (which will also let you export the 
image). You can pull on some atoms, “freeze” them and then optimize the 
geometry with a force field (e.g., MMFF94) to get back the structure.

Hope that helps,
-Geoff
------------------------------------------------------------------------------
Keep yourself connected to Go Parallel: 
TUNE You got it built. Now make it sing. Tune shows you how.
http://goparallel.sourceforge.net
_______________________________________________
OpenBabel-Devel mailing list
OpenBabel-Devel@lists.sourceforge.net
https://lists.sourceforge.net/lists/listinfo/openbabel-devel

Reply via email to