> And now for something completely different ... I'm looking for an image of a > DNA strand that's quite long and that I can manipulate.
Here’s my suggestion. If you make up a Fasta file, Open Babel can generate XYZ coordinates, e.g. >DNA GATTACAGATTACAGATTACA So that’s, say “dna.fasta” babel dna.fasta dna.xyz OK, now you have the normal double-helix. So you want to manipulate it. My suggestion, naturally, is to use Avogadro (which will also let you export the image). You can pull on some atoms, “freeze” them and then optimize the geometry with a force field (e.g., MMFF94) to get back the structure. Hope that helps, -Geoff ------------------------------------------------------------------------------ Keep yourself connected to Go Parallel: TUNE You got it built. Now make it sing. Tune shows you how. http://goparallel.sourceforge.net _______________________________________________ OpenBabel-Devel mailing list OpenBabel-Devel@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/openbabel-devel