Hi,
I have a code that can be executed the following way:
$ ./mycode [param1] [param2] [input1-fasta] [input2-fasta] [output-file]
To execute it for example:
$ ./mycode 4 4 input.fasta input2.fasta output.txt
Typically the code would do all-against-all sequence comparison.
Fasta files look like this:
>Seq_1
TTTGTTTGCTTCATATTGTAATTAATTTTAAAGAAA
>Seq_2
CTGTGACAAATTGCCCTTAACCCTGTGACAAATTGC
Note that the number of sequences of both input may be different.
What I want to do is to run that code command with multiple core and
chunking the files automatically using [GNU Parallel][1].
Hoping that it would run faster.
So I tried this command:
$ parallel --pipe --recstart '>' "./mycode 4 4 input.fasta
input2.fasta output.txt"
But it fail to execute and it give me this instead:
parallel: Warning: Input is read from the terminal. Only experts
do this on purpose. Press CTRL-D to exit.
What's the right way to do it?
- P.D.
[1]: http://www.gnu.org/software/parallel/