Hi all,
I would like to ask you, please, some help in using parallel with blast
alignment software.
I am trying to use GNU parallel v. 20150122 with blast for a very large
sequences alignment. I am using Parallel on a cluster which uses LSF as
queue system.
Input file is a text file with the query sequences having this structure:
>seq1
ACCGGTTTGATTAGATTCCA
CCGGTTTGATTAGATTCCAC
CCACCGGTTTGATTAGATTC
CCACCGGTTTGATATTCCAT
>seq2
ACCGGATTAGATTCCACCTA
ACCGGATTAGATTCCACCTA
ACCGGATTAGATTCCACCTA
ACCGGATTAGATTCCACCTA
....
In this exambple I submit the following command asking LSF for 24 slots:
cat absolute_path_to_sequences.fasta | parallel --no-notice -vv -j 24 --slf
servers --plain --recstart '>' -N 1 --pipe blastp -evalue 1e-05 -outfmt 6
-db absolute_path_to_db_file -query - -out absolute_path_to_result_file_{%}
"servers" is this file:
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
/afs/enea.it/software/bin/blaunch.sh cresco3x013.portici.enea.it
I have to use blaunch instead of ssh here. First I want to say that from
the command above I expect GNU parallel to run 24 BLAST instances on the
slots given by LSF and written on "servers". I also expect 24 result files
to be cat-ed later.
Unfortunately that is not the case.
DB and query sequences are exactly the same so an output is expected but
missing. I just retrieve SOME empy files absolute_path_to_result_file_XX.
My problems are
- I should be able to control exactly the number of blast instances. How do
I set servers file and "-j" option for that?
- the result files are empy and I can see the following messages:
"......
sh -c 'dd bs=1 count=1 of=/tmp/par9piqe.chr 2>/dev/null'; test ! -s
"/tmp/par9piqe.chr" && rm -f "/tmp/par9piqe.chr" && exec true; (cat
/tmp/par9piqe.chr; rm /tmp/par9piqe.chr; cat - ) | (/afs/
enea.it/software/bin/blaunch.sh cresco3x018.portici.enea.it exec perl -e
\\\$ENV\\\{\\\"PARALLEL_PID\\\"\\\}=\\\"30669\\\"\\\;\\\$ENV\\\{\\\"PARALLEL_SEQ\\\"\\\}=\\\"648\\\"\\\;\\\$bashfunc\\\
=\\\ \\\"\\\"\\\;@ARGV=\\\"blastp\\\ -evalue\\\ 1e-05\\\ -outfmt\\\ 6\\\
-db\\\
/gporq1_1M/usr/aprea/bio/solanum_melongena/analysis/orthomcl_00/goodProteins_first_0010000\\\
-query\\\ -\\\ -out\\\
/gporq1_1M/usr/aprea/bio/solanum_melongena/analysis/orthomcl_00/resultd_39\\\"\\\;\\\$SIG\\\{CHLD\\\}=sub\\\{\\\$done=1\\\;\\\}\\\;\\\$pid=fork\\\;unless\\\(\\\$pid\\\)\\\{setpgrp\\\;exec\\\$ENV\\\{SHELL\\\},\\\"-c\\\",\\\(\\\$bashfunc.\\\"@ARGV\\\"\\\)\\\;die\\\"exec:\\\$\\\!\\\\n\\\"\\\;\\\}do\\\{\\\$s=\\\$s\\\<1\\\?0.001+\\\$s\\\*1.03:\\\$s\\\;select\\\(undef,undef,undef,\\\$s\\\)\\\;\\\}until\\\(\\\$done\\\|\\\|getppid==1\\\)\\\;kill\\\(SIGHUP,-\\\$\\\{pid\\\}\\\)unless\\\$done\\\;wait\\\;exit\\\(\\\$\\\?\\\&127\\\?128+\\\(\\\$\\\?\\\&127\\\):1+\\\$\\\?\\\>\\\>8\\\););
sh -c 'dd bs=1 count=1 of=/tmp/pariINik.chr 2>/dev/null'; test ! -s
"/tmp/pariINik.chr" && rm -f "/tmp/pariINik.chr" && exec true; (cat
/tmp/pariINik.chr; rm /tmp/pariINik.chr; cat - ) | (/afs/
enea.it/software/bin/blaunch.sh cresco3x018.portici.enea.it exec perl -e
\\\$ENV\\\{\\\"PARALLEL_PID\\\"\\\}=\\\"30669\\\"\\\;\\\$ENV\\\{\\\"PARALLEL_SEQ\\\"\\\}=\\\"687\\\"\\\;\\\$bashfunc\\\
=\\\ \\\"\\\"\\\;@ARGV=\\\"blastp\\\ -evalue\\\ 1e-05\\\ -outfmt\\\ 6\\\
-db\\\
/gporq1_1M/usr/aprea/bio/solanum_melongena/analysis/orthomcl_00/goodProteins_first_0010000\\\
-query\\\ -\\\ -out\\\
/gporq1_1M/usr/aprea/bio/solanum_melongena/analysis/orthomcl_00/resultd_24\\\"\\\;\\\$SIG\\\{CHLD\\\}=sub\\\{\\\$done=1\\\;\\\}\\\;\\\$pid=fork\\\;unless\\\(\\\$pid\\\)\\\{setpgrp\\\;exec\\\$ENV\\\{SHELL\\\},\\\"-c\\\",\\\(\\\$bashfunc.\\\"@ARGV\\\"\\\)\\\;die\\\"exec:\\\$\\\!\\\\n\\\"\\\;\\\}do\\\{\\\$s=\\\$s\\\<1\\\?0.001+\\\$s\\\*1.03:\\\$s\\\;select\\\(undef,undef,undef,\\\$s\\\)\\\;\\\}until\\\(\\\$done\\\|\\\|getppid==1\\\)\\\;kill\\\(SIGHUP,-\\\$\\\{pid\\\}\\\)unless\\\$done\\\;wait\\\;exit\\\(\\\$\\\?\\\&127\\\?128+\\\(\\\$\\\?\\\&127\\\):1+\\\$\\\?\\\>\\\>8\\\););
sh -c 'dd bs=1 count=1 of=/tmp/parUO93M.chr 2>/dev/null'; test ! -s
"/tmp/parUO93M.chr" && rm -f "/tmp/parUO93M.chr" && exec true; (cat
/tmp/parUO93M.chr; rm /tmp/parUO93M.chr; cat - ) | (/afs/
enea.it/software/bin/blaunch.sh cresco3x010.portici.enea.it exec perl -e
\\\$ENV\\\{\\\"PARALLEL_PID\\\"\\\}=\\\"30669\\\"\\\;\\\$ENV\\\{\\\"PARALLEL_SEQ\\\"\\\}=\\\"692\\\"\\\;\\\$bashfunc\\\
=\\\ \\\"\\\"\\\;@ARGV=\\\"blastp\\\ -evalue\\\ 1e-05\\\ -outfmt\\\ 6\\\
-db\\\
/gporq1_1M/usr/aprea/bio/solanum_melongena/analysis/orthomcl_00/goodProteins_first_0010000\\\
-query\\\ -\\\ -out\\\
/gporq1_1M/usr/aprea/bio/solanum_melongena/analysis/orthomcl_00/resultd_8\\\"\\\;\\\$SIG\\\{CHLD\\\}=sub\\\{\\\$done=1\\\;\\\}\\\;\\\$pid=fork\\\;unless\\\(\\\$pid\\\)\\\{setpgrp\\\;exec\\\$ENV\\\{SHELL\\\},\\\"-c\\\",\\\(\\\$bashfunc.\\\"@ARGV\\\"\\\)\\\;die\\\"exec:\\\$\\\!\\\\n\\\"\\\;\\\}do\\\{\\\$s=\\\$s\\\<1\\\?0.001+\\\$s\\\*1.03:\\\$s\\\;select\\\(undef,undef,undef,\\\$s\\\)\\\;\\\}until\\\(\\\$done\\\|\\\|getppid==1\\\)\\\;kill\\\(SIGHUP,-\\\$\\\{pid\\\}\\\)unless\\\$done\\\;wait\\\;exit\\\(\\\$\\\?\\\&127\\\?128+\\\(\\\$\\\?\\\&127\\\):1+\\\$\\\?\\\>\\\>8\\\););
sh -c 'dd bs=1 count=1 of=/tmp/par3v_gT.chr 2>/dev/null'; test ! -s
"/tmp/par3v_gT.chr" && rm -f "/tmp/par3v_gT.chr" && exec true; (cat
/tmp/par3v_gT.chr; rm /tmp/par3v_gT.chr; cat - ) | (/afs/
enea.it/software/bin/blaunch.sh cresco3x012.portici.enea.it exec perl -e
\\\$ENV\\\{\\\"PARALLEL_PID\\\"\\\}=\\\"30669\\\"\\\;\\\$ENV\\\{\\\"PARALLEL_SEQ\\\"\\\}=\\\"666\\\"\\\;\\\$bashfunc\\\
=\\\ \\\"\\\"\\\;@ARGV=\\\"blastp\\\ -evalue\\\ 1e-05\\\ -outfmt\\\ 6\\\
-db\\\
/gporq1_1M/usr/aprea/bio/solanum_melongena/analysis/orthomcl_00/goodProteins_first_0010000\\\
-query\\\ -\\\ -out\\\
/gporq1_1M/usr/aprea/bio/solanum_melongena/analysis/orthomcl_00/resultd_28\\\"\\\;\\\$SIG\\\{CHLD\\\}=sub\\\{\\\$done=1\\\;\\\}\\\;\\\$pid=fork\\\;unless\\\(\\\$pid\\\)\\\{setpgrp\\\;exec\\\$ENV\\\{SHELL\\\},\\\"-c\\\",\\\(\\\$bashfunc.\\\"@ARGV\\\"\\\)\\\;die\\\"exec:\\\$\\\!\\\\n\\\"\\\;\\\}do\\\{\\\$s=\\\$s\\\<1\\\?0.001+\\\$s\\\*1.03:\\\$s\\\;select\\\(undef,undef,undef,\\\$s\\\)\\\;\\\}until\\\(\\\$done\\\|\\\|getppid==1\\\)\\\;kill\\\(SIGHUP,-\\\$\\\{pid\\\}\\\)unless\\\$done\\\;wait\\\;exit\\\(\\\$\\\?\\\&127\\\?128+\\\(\\\$\\\?\\\&127\\\):1+\\\$\\\?\\\>\\\>8\\\););
......"
"......
Apr 15 15:29:11 2015 21417 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
Apr 15 15:29:10 2015 21469 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
Apr 15 15:29:10 2015 21491 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
Apr 15 15:29:12 2015 20721 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
Apr 15 15:29:14 2015 21426 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
Apr 15 15:29:18 2015 20543 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
Apr 15 15:29:21 2015 20702 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
Apr 15 15:29:21 2015 20862 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
Apr 15 15:29:21 2015 20942 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
Apr 15 15:29:21 2015 21109 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
Apr 15 15:29:21 2015 21287 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
Apr 15 15:29:23 2015 20655 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
Apr 15 15:29:23 2015 20999 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
Apr 15 15:29:23 2015 21259 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
Apr 15 15:29:27 2015 20764 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
Apr 15 15:29:27 2015 21275 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
Apr 15 15:29:29 2015 21422 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
Apr 15 15:29:32 2015 20992 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
Apr 15 15:29:32 2015 21286 3 7.03 lsb_launch(): Failed while waiting for
tasks to finish.
....."
from stdout and stderr, respectively.
Please, does anyone have any idea what am I doing wrong?
Many thanks in advance,
Giuseppe