hello perl6 people, On
This is perl6 version 2012.09.1 built on parrot 4.6.0 revision 0 When i try to run use v6; use Test; for 'GATGGAACTTGACTACGTAAATT' { s:g/T/U/; is $_ , 'GAUGGAACUUGACUACGUAAAUU' , 'RNA'; } I get Cannot assign to a non-container in sub infix:<=> at src/gen/CORE.setting:11692 in block at /tmp/ZZZ:4 As far as i understand from the doc, s:g/T/U/ is a valid syntax. any idea? regards marc