I'm trying to use use Perl 6 to process some nucleotide sequences. However, I
found it strangely slow on substr or string concat operations, compared with
its Perl 5 equivalent.
Here are the codes, Perl 6 on top, Perl 5 on middle, a test input file on
bottom (should be stored to "makeseq.fasta"). The Perl 6's revcom() sub works
very slow.
#########################################################################!/usr/bin/perl6use
v6;use Bio::SeqIO;
say "program initialized";my $IN = Bio::SeqIO.new('fasta','makeseq.fasta');
say "input stream created";
while (my $obj = $IN.next_seq) { say "\tid: <",$obj.display_id,">";
say "\tseq: <{$obj.seq}>"; say "\trev: <{revcom($obj.seq)}>";}
sub revcom(Str $seq) { my $len = $seq.chars; my $result; loop (my
$i=$len-1; $i>=0; $i--) { given ($seq.substr($i,1)) {
when ('A') {$result~='T'} when ('T')
{$result~='A'} when ('G') {$result~='C'}
when ('C') {$result~='G'} when ('a') {$result~='t'}
when ('t') {$result~='a'} when ('g')
{$result~='c'} when ('c') {$result~='g'} }
} return
$result;}########################################################################
#!/usr/bin/perl
use strict;use Bio::SeqIO;use feature qw/say switch/;
say "program initialized";
my $IN = Bio::SeqIO->new(-file=>'makeseq.fasta');
say "input stream created";
while (my $obj = $IN->next_seq) { say "\tid: <",$obj->display_id,">"; say
"\tseq: <",$obj->seq,">"; say "\trev: <",revcom($obj->seq),">";}
sub revcom { my $seq = shift; my $len = length $seq; my $result;
for (my $i=$len-1; $i>=0; $i--) { given (substr $seq,$i,1) {
when ('A') {$result.='T'} when ('T')
{$result.='A'} when ('G') {$result.='C'}
when ('C') {$result.='G'} when ('a') {$result.='t'}
when ('t') {$result.='a'} when ('g')
{$result.='c'} when ('c') {$result.='g'} }
} return $result;}
########################################################################>EMBOSS_001ccgacaacgaatatacgggctgtttgcttgcgtttgagaggtcgtattcccagatgcgtaacgtagcgctccactccgttcgaaaggccggaggaaacaatcgctgaacaactgggtagacataaccatgtcgtctctgtgctactcccggggccacgggtatattaaggcagataaggttgcttagtgggacctataac>EMBOSS_002cggattcagaattggacccggaagcatgcaggcgtggaatgtgggggggttaagggaccgaagtatttcgttactattccgatagtatccgatgagtccgtagcgggatgcacgtcataatcctagccttgaacgaccgggtactggttacgcaattccacccatgtaccttcccacagcccacatgcgacttatttttt>EMBOSS_003tctacgtatgggaataggacgtgctcaatacacgcatggcttgccgtccatcgggaaaaagcgttgcaagtcaaagagctaggcttaacctggactgagtggtcattgcgccgatgcacggcctgcctcagcgctgggagtaatttttcgtcaccccatagcaagtgtattgtagcgtcatcccaggcctcgaggcctaa>EMBOSS_004gtcccctgccgaacgcgccactctcccgcggtgcttaatcgagttggactcaccggggacctaccacacaacaccggatgcgctaactccgggcatctgtcgcaaggcttcatggaaccctacactggtaatcatggtaatagattcaacgtgggttccgttcatatagacaccactcacaaaggcgttcgtgccctgat>EMBOSS_005atatcactcagcctgtggacgtgagttttccacccgcgctcactctcgctgtagattatgtcggggagagaacgtagaatctgtaatcatcggtcatatgaagtaatccaccgacaccgagcaacgttgctactgacaacgggacatttaagagtgctggaaaaaaattgagttattccgcctggataattggcggtttg
_________________________________________________________________
Hotmail: Trusted email with powerful SPAM protection.
https://signup.live.com/signup.aspx?id=60969
