No leetcode expects answers from the usual suspects, but it is still fun to find an answer in J anyway.
--- Original Message --- From: "Mike Day" <[email protected]> Sent: July 21, 2015 5:15 PM To: [email protected] Subject: Re: [Jprogramming] Substring sequences of a string I've had a look at the Leetcode site. It turns out that it doesn't admit J/APL/K etc solutions. I found myself "submitting" an empty Ruby shell! (I'd thought the submit button would open a new page...) Their latest problem is very easy to solve in J, namely to list the running minimum-over-3-item-windows in a numeric vector, but they're looking for linear-time solutions using fancy techniques which hardly matter to J-ers, but might impress in a C++/C/C#/Ruby/... job interview. Sorry - getting away from Jprogramming as such, M On 21/07/2015 08:29, Mike Day wrote: > I came up with the same as Vijay - this variant allows > you to vary the required length of the sub-string: > > s =: 'AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT' > v =: ((~.#~1<#/.~)@(<\)) > > 4{. 5 v s > +-----+-----+-----+-----+ > |AAAAA|AAAAC|AAACC|AACCC| > +-----+-----+-----+-----+ > > What's your Project Euler Moniker, Jon? I'm "Mike", as > here. It's a long time since I had solved 100% of the > problems. > > Cheers, > > Mike > > On 21/07/2015 05:49, Vijay Lulla wrote: >> Using slightly less space >> >> (~. #~ 1 < #/.~)@(10 ]\ ]) s >> >> On Mon, Jul 20, 2015 at 11:59 PM, Tikkanz <[email protected]> wrote: >>> (i.~ ~: i:~) will find duplicates so how about: >>> >>> ~.@(#~ i.~ ~: i:~)@(10 ]\ ]) s >>> >>> AAAAACCCCC >>> >>> CCCCCAAAAA >>> >>> >>> >>> On Tue, Jul 21, 2015 at 3:51 PM, Jon Hough <[email protected]> wrote: >>> >>>> This is a problem from leetcode.com (similar to Project Euler) >>>> https://leetcode.com/problems/repeated-dna-sequences/ >>>> The problem is to find all 10 letter repeated subsequences from a DNA >>>> string (made of C,G,A,T characters). >>>> My solution: >>>> func =: (I.@:(1&<)@:>@:(1&{)@:(~. ,: <"0@:(#/.~)) { >>>> ])@:(<"1@:(10&(]\))) >>>> e.g. s =: 'AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT' NB. see the link for this >>>> definition >>>> func s >>>> ┌──────────┬──────────┐ >>>> >>>> │AAAAACCCCC│CCCCCAAAAA│ >>>> >>>> └──────────┴──────────┘ >>>> >>>> > > > --- > This email has been checked for viruses by Avast antivirus software. > https://www.avast.com/antivirus > > ---------------------------------------------------------------------- > For information about J forums see http://www.jsoftware.com/forums.htm --- This email has been checked for viruses by Avast antivirus software. https://www.avast.com/antivirus ---------------------------------------------------------------------- For information about J forums see http://www.jsoftware.com/forums.htm ---------------------------------------------------------------------- For information about J forums see http://www.jsoftware.com/forums.htm
