I will make my question a little more clearer. I have close to 60,000 lines of the data similar to the one I posted. There are various numbers next to the sequence (this is basically the number of times the sequence has been found in a particular sample). So, I would need to ignore the ones containing '0' and write all other sequences (excluding the number, since it is trivial) in a new text file, in the following format:
>seq59902 TTTTTTTATAAAATATATAGT >seq59903 TTTTTTTATTTCTTGGCGTTGT >seq59904 TTTTTTTGGTTGCCCTGCGTGG >seq59905 TTTTTTTGTTTATTTTTGGG The number next to 'seq' is the line number of the sequence. When I run the above program, what I expect is an output file that is similar to the above output but with the ones containing '0' ignored. But, I am getting all the sequences printed in the file. Kindly excuse the 'newbieness' of the program. :) I am hoping to improve in the next few months. Thanks to all those who replied. I really appreciate it. :) -- http://mail.python.org/mailman/listinfo/python-list
