Io userei el automa di aho corasick. In Bioinformatics si usa tanto. http://carshen.github.io/data-structures/algorithms/2014/04/07/aho-corasick-implementation-in-python.html
2017-11-26 10:20 GMT+01:00 Giuseppe Costanzi <[email protected]>: > salve a tutti, > > ho una sequenza del tipo > > ACTGATCGATTACGTATAGTAGAATTCTATCATACATATATATCGATGCGTTCAT > > scorrendola devo trovare una sequenza target GAATTC > > ACTGATCGATTACGTATAGTA "GAATTC" TATCATACATATATATCGATGCGTTCAT > > > quindi dividere la sequenza da G, la prima lettera della sequenza target, > e calcolarmi la lunghezza dei due frammenti risultanti > > ACTGATCGATTACGTATAGTAG > > e di questa > > GAATTCTATCATACATATATATCGATGCGTTCAT > > io avrei fatto > > seq = "ACTGATCGATTACGTATAGTAGAATTCTATCATACATATATATCGATGCGTTCAT" > target = "GAATTCT" > > s = [] > > for i,base in enumerate(seq): > > s.append(base) > > if len(s)==8: > > s.pop(0) > > if ''.join(s) == target: > print i-5 > print len(seq)-(i-5) > break > > funziona ma non e' che ne sia proprio convinto, > avete suggerimenti su come iterare la sequenza? > > saluti > beppe > > > p.s. > > e' un esercizio che ho trovato su p4b, python for biologist > > > "Let's start this exercise by solving the problem manually. If we look > through the > DNA sequence we can spot the EcoRI site at position 21. Here's the > sequence with > the base positions labelled above and the EcoRI motif in bold: > > in bold sarebbe questa GAATTCT > > 0123456789012345678901234567890123456789012345678901234 > ACTGATCGATTACGTATAGTAGAATTCTATCATACATATATATCGATGCGTTCAT > Since the EcoRI enzyme cuts the DNA between the G and first A, we can > figure out > that the first fragment will run from position 0 to position 21, and the > second > fragment from position 22 to the last position, 54. Therefore the > lengths of the two > fragments are 22 and 33." > _______________________________________________ > Python mailing list > [email protected] > https://lists.python.it/mailman/listinfo/python >
_______________________________________________ Python mailing list [email protected] https://lists.python.it/mailman/listinfo/python
