> x <- readLines(textConnection("AAAAT + TTTAG + TTAAC + GGATT + ACGTA")) > closeAllConnections() > paste(x, collapse = '') [1] "AAAATTTTAGTTAACGGATTACGTA" >
On Thu, Jul 7, 2011 at 10:37 AM, albert coster <albertcoster2...@gmail.com> wrote: > Dear all, > > I have a input file like following : > > AAAAT > TTTAG > TTAAC > GGATT > ACGTA > > How can I make a single vector with this like > following: AAAATTTTAGTTAACGGATTACGTA > > Best regards > > Albert > > [[alternative HTML version deleted]] > > ______________________________________________ > R-help@r-project.org mailing list > https://stat.ethz.ch/mailman/listinfo/r-help > PLEASE do read the posting guide http://www.R-project.org/posting-guide.html > and provide commented, minimal, self-contained, reproducible code. > -- Jim Holtman Data Munger Guru What is the problem that you are trying to solve? ______________________________________________ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.