Hi, I need to read a string vector in R which is like this "atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as a unique vector input when I read in like x <- "atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I can use each of the letters on my reading?
Thanks, Beatriz -- View this message in context: http://n4.nabble.com/reading-a-string-vector-tp1290289p1290289.html Sent from the R help mailing list archive at Nabble.com. [[alternative HTML version deleted]] ______________________________________________ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
