On 9/5/07, João Fadista <[EMAIL PROTECTED]> wrote: > I would like to know how can I compute the length of a string in a dataframe. > Example: > > SEQUENCE ID > TGCTCCCATCTCCACGG HR04FS000000645 > ACTGAACTCCCATCTCCAAT HR00000595847847 > > I would like to know how to compute the length of each SEQUENCE.
Maybe the following code? > data var1 var2 1 This is a string 12 2 This is another string 34 > nchar(data[,1]) [1] 16 22 > Paul ______________________________________________ R-help@stat.math.ethz.ch mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.