LS,
i updated samtools on my gentoo box using ethe lastest release the portage tree in to test CRAM support and ran some test I used a random BWA alignment filewhich have been sorted and indexed using samtools and noticed that two variables in field nr 12 the OPT variable OPTional fields in the format TAG:VTYPE:VALUE have changed. After converting the BAM file to a CRAM file and back to BAM To be more precise: MD:Z:42 changed to MD:Z:0N4 and NM:i:0 changed to NM:i:1 are the OPT variables that that changed. Also the format of the line is somewhat crippled. version: samtools --version samtools 1.0 Using htslib 1.0 Copyright (C) 2014 Genome Research Ltd. original entry HWI-ST220:133:B06F8ABXX:6:1203:19625:16148 0 chr1 10000 0 42M * 0 0 ATAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACC ;BBFFFFFGHHHHJJJJJJJJJIJJJ>FGGHHJIIJIIGGGI MD:Z:42 NM:i:0 XT:A:U XN:i:1 X0:i:1 X1:i:581 XM:i:0XO:i:0 XG:i:0 and processed entry: HWI-ST220:133:B06F8ABXX:6:1203:19625:16148 0 chr1 10000 0 42M * 0 0 ATAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACC ;BBFFFFFGHHHHJJJJJJJJJIJJJ>FGGHHJIIJIIGGGI XT:A:U XN:i:1 X0:i:1 X1:i:581 XM:i:0 XO:i:0 XG:i:0MD:Z:0N41 NM:i:1 Is this intended or is this a bug ? best KJF ------------------------------------------------------------------------------ Meet PCI DSS 3.0 Compliance Requirements with EventLog Analyzer Achieve PCI DSS 3.0 Compliant Status with Out-of-the-box PCI DSS Reports Are you Audit-Ready for PCI DSS 3.0 Compliance? Download White paper Comply to PCI DSS 3.0 Requirement 10 and 11.5 with EventLog Analyzer http://pubads.g.doubleclick.net/gampad/clk?id=154622311&iu=/4140/ostg.clktrk _______________________________________________ Samtools-help mailing list [email protected] https://lists.sourceforge.net/lists/listinfo/samtools-help
