Thanks for fixing the bug.

I still don't understand why the candidate INDEL "MyRef 120 . G GGAAT" is not 
called, but is reported with a PL of 0 (ie almost 100% likelihood) when the 
"-A" option is present. Is there an explanation of what bcftools considers a 
variant available somewhere?

Best,

Rasmus

Intomics is a contract research organization specialized in deriving core 
biological insight from large scale data. We help our clients in the 
pharmaceutical industry develop tomorrow's medicines better, faster, and 
cheaper through optimized use of biomedical data.
-----------------------------------------------------------------
Hansen, Rasmus Borup              Intomics - from data to biology
System Administrator              Diplomvej 377
Scientific Programmer             DK-2800 Kgs. Lyngby
                                  Denmark
E: [email protected]               W: http://www.intomics.com/
P: +45 5167 7972                  P: +45 8880 7979

> On 05 Nov 2014, at 14:49, Petr Danecek <[email protected]> wrote:
> 
> On Tue, 2014-11-04 at 16:22 +0100, Rasmus Borup Hansen wrote: 
>> Thanks for the reply.
>> 
>> 
>> I tried adding the "-A" option to "bcftools call" in the script. Then,
>> at position 120, I get "GGAAT" in the ALT column, and the genotype
>> field *changes* from "0" to "1:30,0". This genotype looks more like
>> what I'd expect from looking at the alignment using "samtools tview".
> 
> This is correct behavior, with single allele PL field is not output.
> 
>> If I use the "-v" option as well, position 120 is included in the VCF
>> when the "-A" option is present, but not when "-A" is absent.
> 
> This is a bug, -A should not influence sites discarded by -v. This is
> now fixed in github, thanks.
> 
> petr
> 
> 
>> As I understand it, the "-A" option should not change if a variant is
>> called at a position or not, only how the data for the position are
>> output. Please correct me if I'm wrong.
>> 
>> 
>> Best,
>> 
>> 
>> Rasmus
>> 
>> Intomics is a contract research organization specialized in deriving
>> core biological insight from large scale data. We help our clients in
>> the pharmaceutical industry develop tomorrow's medicines better,
>> faster, and cheaper through optimized use of biomedical data.
>> -----------------------------------------------------------------
>> Hansen, Rasmus Borup              Intomics - from data to biology
>> System Administrator              Diplomvej 377
>> Scientific Programmer             DK-2800 Kgs. Lyngby
>>                                  Denmark
>> E: [email protected]               W: http://www.intomics.com/
>> P: +45 5167 7972                  P: +45 8880 7979
>> 
>>> On 04 Nov 2014, at 11:56, Petr Danecek <[email protected]> wrote: 
>>> 
>>> Hi Rasmus,
>>> 
>>> mpileup outputs the candidate indel 
>>> 
>>> MyRef 120 . G GGAAT
>>> 
>>> which is then not called by bcftools (*). The -v option is not
>>> present,
>>> therefore all input records are printed on output. The -A option is
>>> not
>>> present, therefore unused ALT alleles are trimmed. The INDEL tag is
>>> a
>>> reminiscence of the site being a candidate indel.
>>> 
>>> I hope this helps
>>> 
>>> Petr
>>> 
>>> 
>>> (*) that is, with the default options, it would be called with -mP
>>> 0.01 
>>> 
>>> 
>>> 
>>> On Fri, 2014-10-31 at 15:56 +0100, Rasmus Borup Hansen wrote: 
>>>> Hi! I'm getting VCF files with some strange INDELS from bcftools.
>>>> The
>>>> shell script below contains everything needed to reproduce it (I'm
>>>> using bwa 0.7.10-r789, samtools 1.1, and bcftools 1.1) and it
>>>> outputs
>>>> the following:
>>>> 
>>>> 
>>>> Lines for position 120 when the VCF is generated by "samtools
>>>> mpileup":
>>>> 
>>>> 
>>>> MyRef   120     .       G       <X>     0       .
>>>> DP=3;I16=0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0;QS=0,0;MQ0F=0  PL
>>>>     0,0,0
>>>> MyRef   120     .       G       GGAAT   0       .
>>>> INDEL;IDV=2;IMF=0.666667;DP=3;I16=0,0,1,0,0,0,30,900,0,0,60,3600,0,0,25,625;QS=0,1;SGB=-0.379885;MQ0F=0
>>>>       PL      30,3,0
>>>> 
>>>> 
>>>> Lines for position 120 when the VCF is generated by "bcftools
>>>> call":
>>>> 
>>>> 
>>>> MyRef   120     .       G       .       0       .
>>>> DP=3;MQ0F=0;AN=0;DP4=0,0,0,0;MQ=.       GT      .
>>>> MyRef   120     .       G       .       2.1484  .
>>>> INDEL;IDV=2;IMF=0.666667;DP=3;SGB=-0.379885;MQ0F=0;AN=1;DP4=0,0,1,0;MQ=60  
>>>>      GT      0
>>>> 
>>>> 
>>>> Output from "samtools mpileup" around position 120:
>>>> 
>>>> 
>>>> MyRef   110     G       2       .,      mD
>>>> MyRef   111     T       2       .,      bD
>>>> MyRef   112     G       2       .,      eD
>>>> MyRef   113     T       2       .,      jD
>>>> MyRef   114     T       2       C,      kD
>>>> MyRef   115     G       1       .       m
>>>> MyRef   116     G       1       .       e
>>>> MyRef   117     G       1       .       j
>>>> MyRef   118     G       1       .       i
>>>> MyRef   119     A       1       .       k
>>>> MyRef   120     G       0
>>>> MyRef   121     A       0
>>>> MyRef   122     C       1       .       I
>>>> MyRef   123     T       1       .       k
>>>> MyRef   124     C       2       .,      gA
>>>> MyRef   125     A       2       Gg      dA
>>>> MyRef   126     G       2       .,      _A
>>>> MyRef   127     T       2       .,      iF
>>>> MyRef   128     G       2       .,      fH
>>>> MyRef   129     C       2       .,      jJ
>>>> MyRef   130     C       2       .,      iI
>>>> 
>>>> 
>>>> It's the output from "bcftools call" that has ALT="." while the
>>>> "INDEL" flag is present that worries me. Is this a bug, or just
>>>> something I don't understand (yet)?
>>>> 
>>>> 
>>>> The shell script to reproduce the above output:
>>>> 
>>>> 
>>>> #!/bin/bash
>>>> 
>>>> 
>>>> # Make directory for data
>>>> mkdir -p tmp-data
>>>> cd tmp-data
>>>> 
>>>> 
>>>> # Redirect stderr.
>>>> exec 2>stderr
>>>> 
>>>> 
>>>> # Use this short refence.
>>>> cat >ref <<EOF
>>>>> MyRef
>>>> GGTGGCGAAGGCGGCTTGCTGGACAAATACTGACGCTGAGGTGCGAAAGCGTGGGGAGCA
>>>> AACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGCTAGGTGTTGGGGAG
>>>> ACTCAGTGCCGCAGCTAACGCAATAAGCACTCCGCCTGGGGAGTACGACCGCAAGGTTGA
>>>> EOF
>>>> 
>>>> 
>>>> # Use these reads.
>>>> cat >reads.fastq <<EOF
>>>> @Instrument:1:FlowCell:1:1:1:1/1
>>>> ACCTTGCGGTCGTACTCCCCAGGTGGAGTGCTTATTGCGTTTGCTGCGGCACCGACCATCTCTGGCCAACACCTAGCACTCATCGTTTACGGCGTGGA
>>>> +
>>>> CCCFFFFFHFHHGJJJJ3EHGIJ?FHDHFHJJIJJJJJJHIJJJJJJIJHFFDDDDDDDDDDEDCDDDDDDDDDDCCCCDDDDDDBDDDDDDDDDDDD
>>>> @Instrument:1:FlowCell:1:1:1:1/2
>>>> GGTGGCGAAGGCGGCTTACTGGACTGTTACTGACGCTGAGTCACGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACG
>>>> +
>>>> CCBFFFFFHHHHHJJJJJJIJJIIJJJIJJJJJIJJJIJJHHHHHFFFDE9=BDDDDDDDDDDDDDDDDDDDDEDDDDDDADDDEDDDBDDDDDDDD<
>>>> @Instrument:1:FlowCell:1:2:2:2/1
>>>> TCAACCTTGCGGTCGTACTCCCCAGGTGGAGTGCTTATTGCGTTAGCTGCGGCACCGAGGATTCCTCCCCGACACCTAGCACTCATCGTTTACGGCG
>>>> +
>>>> BCCFFFFFHHHGFHIJJGHIIIIHDH?GDFI*BGIHIIJGEGAEEHIHJIGHFFB?@DDBBCDCDCCDBDDDBBDB9CCDDD@?CDDDDDD?@@DBB
>>>> @Instrument:1:FlowCell:1:2:2:2/2
>>>> GGTAGTCCACGCCGTAAACGATGAGTGCTAGGTGTCGGGGAGGAATCCTCGGTGCCGCAGCTAACGCAATAAGCACTCCACCTGGGGAGTACGACCGC
>>>> +
>>>> BBBDFDF?FHHHFHHHIJIJJJIHIHGJIGIJADGHJDGGIGGGFHHHHHF>DACCDBDBDDDDDBDD@DDCDDDDDDDCDDDCBBB@DDCDDDBDBB
>>>> EOF
>>>> 
>>>> 
>>>> # Prepare indices of the reference.
>>>> samtools faidx ref
>>>> bwa index ref
>>>> 
>>>> 
>>>> # Align the reads to the reference.
>>>> bwa mem -p -t 4 -R '@RG\tID:MySample\tSM:MySample' ref reads.fastq
>>>>> 
>>>> alignment.sam
>>>> 
>>>> 
>>>> # bwa-mem needs to infer the insert size distribution from data.
>>>> You
>>>> # have to mix the read pair with at least tens of other pairs. For
>>>> # this reason bwa doesn't think the reads are properly paired, so
>>>> we
>>>> # set the flags manually.
>>>> perl -pe '@_=split /\t/; if ($_[0] !~ /^@/) { @_[1] |= 2;
>>>> $_=join("\t", @_) }' alignment.sam > fixed_alignment.sam
>>>> 
>>>> 
>>>> # Sort the alignment.
>>>> samtools sort -T samtools.sort fixed_alignment.sam -O bam >
>>>> sorted_alignment.bam
>>>> 
>>>> 
>>>> # Index the sorted alignment.
>>>> samtools index sorted_alignment.bam
>>>> 
>>>> 
>>>> # Make a file containing the ploidy of the sample (for "bcftools
>>>> call
>>>> -m").
>>>> echo -e >sample.tab "MySample\t1"
>>>> 
>>>> 
>>>> # Generate vcf using samtools.
>>>> samtools mpileup -r MyRef:110-130 -vuf ref sorted_alignment.bam >
>>>> pos110-130.samtools.vcf
>>>> 
>>>> 
>>>> # Generate vcf using bcftools.
>>>> samtools mpileup -r MyRef:110-130 -uf ref sorted_alignment.bam |
>>>> bcftools call -m -S sample.tab -O v > pos110-130.bcftools.vcf
>>>> 
>>>> 
>>>> # Generate mpileup data.
>>>> samtools mpileup -r MyRef:110-130 -f ref sorted_alignment.bam >
>>>> mpileup.tab
>>>> 
>>>> 
>>>> # Output results.
>>>> echo -e "\nLines for position 120 when the VCF is generated by
>>>> \"samtools mpileup\":\n"
>>>> grep -P '^MyRef\t120' pos110-130.samtools.vcf
>>>> echo -e "\nLines for position 120 when the VCF is generated by
>>>> \"bcftools call\":\n"
>>>> grep -P '^MyRef\t120' pos110-130.bcftools.vcf
>>>> echo -e "\nOutput from \"samtools mpileup\" around position 120:
>>>> \n"
>>>> cat mpileup.tab
>>>> echo
>>>> 
>>>> 
>>>> ### END OF SCRIPT
>>>> 
>>>> 
>>>> 
>>>> 
>>>> Best,
>>>> 
>>>> 
>>>> Rasmus Borup Hansen
>>>> 
>>>> Intomics is a contract research organization specialized in
>>>> deriving
>>>> core biological insight from large scale data. We help our clients
>>>> in
>>>> the pharmaceutical industry develop tomorrow's medicines better,
>>>> faster, and cheaper through optimized use of biomedical data.
>>>> -----------------------------------------------------------------
>>>> Hansen, Rasmus Borup              Intomics - from data to biology
>>>> System Administrator              Diplomvej 377
>>>> Scientific Programmer             DK-2800 Kgs. Lyngby
>>>>                                 Denmark
>>>> E: [email protected]               W: http://www.intomics.com/
>>>> P: +45 5167 7972                  P: +45 8880 7979
>>>> 
>>>> ------------------------------------------------------------------------------
>>>> _______________________________________________
>>>> Samtools-help mailing list
>>>> [email protected]
>>>> https://lists.sourceforge.net/lists/listinfo/samtools-help
>>> 
>>> 
>>> 
>>> 
>>> -- 
>>> The Wellcome Trust Sanger Institute is operated by Genome Research 
>>> Limited, a charity registered in England with number 1021457 and a 
>>> company registered in England with number 2742969, whose registered 
>>> office is 215 Euston Road, London, NW1 2BE. 
>>> 
>> 
>> ------------------------------------------------------------------------------
>> _______________________________________________
>> Samtools-help mailing list
>> [email protected]
>> https://lists.sourceforge.net/lists/listinfo/samtools-help
> 
> 
> 
> 
> -- 
> The Wellcome Trust Sanger Institute is operated by Genome Research 
> Limited, a charity registered in England with number 1021457 and a 
> company registered in England with number 2742969, whose registered 
> office is 215 Euston Road, London, NW1 2BE. 

------------------------------------------------------------------------------
_______________________________________________
Samtools-help mailing list
[email protected]
https://lists.sourceforge.net/lists/listinfo/samtools-help

Reply via email to