I believe the new CSI index should work, try "samtools index -c
file.bam"

petr


On Tue, 2014-12-16 at 12:16 -0500, Heng Li wrote:
> Samtools index doesn't work with a chromosome longer than 512Mbp.
> 
> Heng
> 
> On Dec 16, 2014, at 11:41, olivier.rue <[email protected]> wrote:
> 
> > Hello,
> > 
> > I got an error when indexing my sorted BAM file.
> > 
> > > samtools index file.bam
> > [E::hts_idx_push] NO_COOR reads not in a single block at the end 0 -1
> > 
> > I tried to check the validity of the file with picard-tools:
> > 
> > > java -jar ValidateSamFile.jar I=file.bam IGNORE_WARNINGS=true
> > ERROR: Record 90709, Read name seq40369#11#7696, The record is out of 
> > [coordinate] order, prior read name [seq28047#7#2353], prior coodinates 
> > [-1:0]
> > 
> > The start coordinate of this read is higher than 1 billion:
> > 
> > seq40369#11#7696    272    chrUn    1024548131    1    27M    *    0    0   
> >  GTTGTCTCTGATTCAGAATCATACTTA    IIIIIIIIIIIIIIIIIIIIIIIIIII    AS:i:0    
> > XS:i:0    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:27    
> > YT:Z:UU
> > 
> > I retrieved identical problems with bedtools...
> > 
> > Do you have already encountered this bug ?
> > 
> > Thanks,
> > Olivier
> > 
> > -- 
> > ========================================================
> >  Olivier RUÉ
> >  INRA - MIAT - Plateforme Bioinfo-Genotoul
> >  Chemin de Borde-Rouge - Auzeville - CS 52627
> >  31326 Castanet-Tolosan cedex - FRANCE
> >  Tel: +33 (0)5.61.28.55.49
> >  
> > http://www.bioinfo.genotoul.fr/ 
> > ------------------------------------------------------------------------------
> > Download BIRT iHub F-Type - The Free Enterprise-Grade BIRT Server
> > from Actuate! Instantly Supercharge Your Business Reports and Dashboards
> > with Interactivity, Sharing, Native Excel Exports, App Integration & more
> > Get technology previously reserved for billion-dollar corporations, FREE
> > http://pubads.g.doubleclick.net/gampad/clk?id=164703151&iu=/4140/ostg.clktrk_______________________________________________
> > Samtools-help mailing list
> > [email protected]
> > https://lists.sourceforge.net/lists/listinfo/samtools-help
> 
> 
> ------------------------------------------------------------------------------
> Download BIRT iHub F-Type - The Free Enterprise-Grade BIRT Server
> from Actuate! Instantly Supercharge Your Business Reports and Dashboards
> with Interactivity, Sharing, Native Excel Exports, App Integration & more
> Get technology previously reserved for billion-dollar corporations, FREE
> http://pubads.g.doubleclick.net/gampad/clk?id=164703151&iu=/4140/ostg.clktrk
> _______________________________________________
> Samtools-help mailing list
> [email protected]
> https://lists.sourceforge.net/lists/listinfo/samtools-help




-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 

------------------------------------------------------------------------------
Download BIRT iHub F-Type - The Free Enterprise-Grade BIRT Server
from Actuate! Instantly Supercharge Your Business Reports and Dashboards
with Interactivity, Sharing, Native Excel Exports, App Integration & more
Get technology previously reserved for billion-dollar corporations, FREE
http://pubads.g.doubleclick.net/gampad/clk?id=164703151&iu=/4140/ostg.clktrk
_______________________________________________
Samtools-help mailing list
[email protected]
https://lists.sourceforge.net/lists/listinfo/samtools-help

Reply via email to