I believe the new CSI index should work, try "samtools index -c file.bam"
petr On Tue, 2014-12-16 at 12:16 -0500, Heng Li wrote: > Samtools index doesn't work with a chromosome longer than 512Mbp. > > Heng > > On Dec 16, 2014, at 11:41, olivier.rue <[email protected]> wrote: > > > Hello, > > > > I got an error when indexing my sorted BAM file. > > > > > samtools index file.bam > > [E::hts_idx_push] NO_COOR reads not in a single block at the end 0 -1 > > > > I tried to check the validity of the file with picard-tools: > > > > > java -jar ValidateSamFile.jar I=file.bam IGNORE_WARNINGS=true > > ERROR: Record 90709, Read name seq40369#11#7696, The record is out of > > [coordinate] order, prior read name [seq28047#7#2353], prior coodinates > > [-1:0] > > > > The start coordinate of this read is higher than 1 billion: > > > > seq40369#11#7696 272 chrUn 1024548131 1 27M * 0 0 > > GTTGTCTCTGATTCAGAATCATACTTA IIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 > > XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:27 > > YT:Z:UU > > > > I retrieved identical problems with bedtools... > > > > Do you have already encountered this bug ? > > > > Thanks, > > Olivier > > > > -- > > ======================================================== > > Olivier RUÉ > > INRA - MIAT - Plateforme Bioinfo-Genotoul > > Chemin de Borde-Rouge - Auzeville - CS 52627 > > 31326 Castanet-Tolosan cedex - FRANCE > > Tel: +33 (0)5.61.28.55.49 > > > > http://www.bioinfo.genotoul.fr/ > > ------------------------------------------------------------------------------ > > Download BIRT iHub F-Type - The Free Enterprise-Grade BIRT Server > > from Actuate! Instantly Supercharge Your Business Reports and Dashboards > > with Interactivity, Sharing, Native Excel Exports, App Integration & more > > Get technology previously reserved for billion-dollar corporations, FREE > > http://pubads.g.doubleclick.net/gampad/clk?id=164703151&iu=/4140/ostg.clktrk_______________________________________________ > > Samtools-help mailing list > > [email protected] > > https://lists.sourceforge.net/lists/listinfo/samtools-help > > > ------------------------------------------------------------------------------ > Download BIRT iHub F-Type - The Free Enterprise-Grade BIRT Server > from Actuate! Instantly Supercharge Your Business Reports and Dashboards > with Interactivity, Sharing, Native Excel Exports, App Integration & more > Get technology previously reserved for billion-dollar corporations, FREE > http://pubads.g.doubleclick.net/gampad/clk?id=164703151&iu=/4140/ostg.clktrk > _______________________________________________ > Samtools-help mailing list > [email protected] > https://lists.sourceforge.net/lists/listinfo/samtools-help -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE. ------------------------------------------------------------------------------ Download BIRT iHub F-Type - The Free Enterprise-Grade BIRT Server from Actuate! Instantly Supercharge Your Business Reports and Dashboards with Interactivity, Sharing, Native Excel Exports, App Integration & more Get technology previously reserved for billion-dollar corporations, FREE http://pubads.g.doubleclick.net/gampad/clk?id=164703151&iu=/4140/ostg.clktrk _______________________________________________ Samtools-help mailing list [email protected] https://lists.sourceforge.net/lists/listinfo/samtools-help
