Hey Kevin,

Could you provide me with a small test case on which to verify the
behavior.  We would also likely need the reference sequence too.

N

On Sun, Feb 15, 2015 at 12:48 PM, Kevin Rue-Albrecht <
[email protected]> wrote:

> Dear all,
>
> After various unsuccessful attempts, and browsing the archive (partially
> fixed my problem), I am afraid I have to post here for help fixing my issue.
>
> I am trying to use CollectAlignmentSummaryMetrics for bisulfite
> libraries. My problem is that adapters are not detected by Picard while I
> can clearly find 3.5% of the first 1,000,000 read pairs with the first mate
> containing the reverse complement of the reverse strand adapter (i.e.
> perfect match to the adapter sequence detected by grep command). Maybe I am
> using the ADAPTER_SEQUENCE of Picard wrong?
>
> Similarly to the post
> https://sourceforge.net/p/samtools/mailman/message/32771613/ I was
> getting a lot of zeros when the reference genome sequence was not
> specified. However, giving a reference genome did not improve the detection
> of adapter sequences. Anything I am missing to detect the adapter sequences
> in my command line below ?
>
> Here is the command I used (in doubt, I gave the two adapter sequences +
> the two reverse complement sequences, but apparently none are detected):
> java -jar /usr/local/src/picard-tools-1.128/picard.jar
> CollectAlignmentSummaryMetrics
> INPUT=/workspace/scratch/krue/Methylation/bwa_8lanes/C12.bam
> OUTPUT=/workspace/scratch/krue/Methylation/bwa_8lanes/C12.test_picard_summary.txt
> ADAPTER_SEQUENCE=null ADAPTER_SEQUENCE=GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
> ADAPTER_SEQUENCE=TACACTCTTTCCCTACACGACGCTCTTCCGATCT
> ADAPTER_SEQUENCE=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
> ADAPTER_SEQUENCE=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
> IS_BISULFITE_SEQUENCED=true
> REFERENCE_SEQUENCE=/workspace/storage/genomes/bostaurus/UMD3.1.75/source_file/Bos_taurus.UMD3.1.75.dna.toplevel.fa
> STOP_AFTER=100000
>
> When I tested the SAM file, PicardValidateSamFile
> <http://broadinstitute.github.io/picard/command-line-overview.html#ValidateSamFile>
> returned only one error:
> ERROR: Read name C12_TAGCTT_L002_R_001, A platform (PL) attribute was not
> found for read group
>
>
> Many thanks in advance, and I hope I didn't miss an embarrassingly obvious
> explanation somewhere
> Kevin
>
> --
> Kévin RUE-ALBRECHT
> Wellcome Trust Computational Infection Biology PhD Programme
> University College Dublin
> Ireland
> http://fr.linkedin.com/pub/k%C3%A9vin-rue/28/a45/149/en
>
>
> ------------------------------------------------------------------------------
> Dive into the World of Parallel Programming. The Go Parallel Website,
> sponsored by Intel and developed in partnership with Slashdot Media, is
> your
> hub for all things parallel software development, from weekly thought
> leadership blogs to news, videos, case studies, tutorials and more. Take a
> look and join the conversation now. http://goparallel.sourceforge.net/
> _______________________________________________
> Samtools-help mailing list
> [email protected]
> https://lists.sourceforge.net/lists/listinfo/samtools-help
>
>
------------------------------------------------------------------------------
Download BIRT iHub F-Type - The Free Enterprise-Grade BIRT Server
from Actuate! Instantly Supercharge Your Business Reports and Dashboards
with Interactivity, Sharing, Native Excel Exports, App Integration & more
Get technology previously reserved for billion-dollar corporations, FREE
http://pubads.g.doubleclick.net/gampad/clk?id=190641631&iu=/4140/ostg.clktrk
_______________________________________________
Samtools-help mailing list
[email protected]
https://lists.sourceforge.net/lists/listinfo/samtools-help

Reply via email to