Hi Alison,
On Sat, 2015-11-28 at 13:04 +0000, Wright, Alison wrote: > Hi Petr, > > Thanks very much for all of your help. > > I would be very grateful for some help with the questions I have. Thanks again > > 1. Why I have read that setting -q 1 when running mpileup means only > uniquely mapping reads are considered? > I have this read > HISEQ2500-09:92:H8PJKADXX:1:1101:5415:2846 99 NC_024331.1 > 24859997 4 76M3D1M2D23M = 24860151 255 > GATATTTGAGTTAATGTATGATGTGAAATGTGACTTTTTATTACATACTGTATCGATTATGGGACTATAACTCAACATCAAGTAAGGCTGCTGTCACTTA > > CCCFFFFFHHHHHJJJIJJJJJJIJJJJJJJJJJJJJJJJJJJJJJJJJJIJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJHHHHHHFFFFEEEEEEED > AS:i:-37 XS:i:-58 XN:i:0 XM:i:2 XO:i:2 XG:i:5 NM:i:7 > MD:Z:48C23T3^TCA1^GG23 YS:i:-8 YT:Z:CP > This is clearly not a uniquely mapping read (due to presence of XS > flag) but it has a MAPQ score of 4. Therefore, this would not be > filtered out using -q 1? Some (most?) aligners set mapping quality to 0 when the placement of a read is ambiguous. The XS flag is not checked by samtools. > 2. I see the option -A, --count-orphans. If you don't set this then I > understand anomalous read pairs are skipped in variant calling. If > mpileup isn't reading the flags about mate status then how does it know > which are anomalous read pairs? > I use the following mpileup command after sorting the filtered bam file > with samtools: samtools mpileup -BAd 10000000 > With this command, is it ok to use my custom approach of filtering the > bam files? The UNMAP,SECONDARY,QCFAIL,DUP should not be altered, the > only thing that changes is the status of the mate. By specifying -A > then presumably I am telling mpileup to ignore the status of the mate? With the -A option, all reads with the PAIRED bit set (paired-end sequencing technology) are required to have also the PROPER_PAIR bit set. This filter is performed after the --rf and --ff filters are applied. > 3. does pileup ignore reads with the flags UNMAP,SECONDARY,QCFAIL,DUP > by default or only when --ff, --excl-flags STR|INT is specified? --excl-flags UNMAP,SECONDARY,QCFAIL,DUP is the default behaviour. > 4. I get the following message when I run mpileup > samtools mpileup -BAd 10000000 -f reference file sample1.bam sample2.bam > sample3.bam etc >cohort.pileup > > [mpileup] 19 samples in 19 input files > (mpileup) Max depth is above 1M. Potential memory hog! > > Will I be missing sites with high depth? If the depth is too big, some reads may be ignored, but all sites are considered. Petr > Thanks very much! > > Alison > > --- > > Dr Alison Wright > > Postdoctoral Research Associate > University College London > Department of Genetics, Evolution and Environment > The Darwin Building > Gower Street > London WC1E 6BT > > www.ucl.ac.uk/mank-group/ -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE. ------------------------------------------------------------------------------ Go from Idea to Many App Stores Faster with Intel(R) XDK Give your users amazing mobile app experiences with Intel(R) XDK. Use one codebase in this all-in-one HTML5 development environment. Design, debug & build mobile apps & 2D/3D high-impact games for multiple OSs. http://pubads.g.doubleclick.net/gampad/clk?id=254741551&iu=/4140 _______________________________________________ Samtools-help mailing list [email protected] https://lists.sourceforge.net/lists/listinfo/samtools-help
