On 29-02-2012, at 07:03, lidaky wrote:
Hi,
today i wrote a function in R of the type:
index.refraction - function(Temp,Press, RH, CO2)
When i try to plug a negative number in Temp, i got this type of error:
n - index.refraction(Temp= -40,100,80,CO2)
Messages d'avis :
1: In
On Tue, Feb 28, 2012 at 11:42:32AM -0800, helin_susam wrote:
Dear Petr Savicky,
Actually, this is based on jackknife after bootstrap algorithm. In summary,
I have a data set, and I want to compute some values by using this
algorithm.
Firstly, using bootstrap, I create some bootstrap
Sorry, I was not particularly clear.
I ran my data through a GLM (the response variable is a proportion, and I
ignored the random effects for the purposes of data exploration), and
plotted the residuals against each of my predictor variables (some of which
are continuous, some categorical). The
Le mardi 28 février 2012 à 02:48 -0800, sazzle a écrit :
Hi, I'm wondering if you can help me, this is a really simple query but I
keep getting confused. I have run a GLM to see how boldness varies over
time following a particular treatment. The results are as follows...
Call: glm(formula
Ah yes, I can open it with Notepad...it reads the following:
* installing *source* package 'QRMlib' ...
** Creating default NAMESPACE file
** libs
ERROR: compilation failed for package 'QRMlib'
* removing 'C:/PROGRA~1/R/R-214~1.1/bin/QRMLIB~1.RCH/QRMlib'
--
View this message in context:
Hi all,
I am new to R and have some trouble with exporting results from a non linear
squares object (.nls), would be very thankful if anyone could help me.
So what I'm doing is a Bass modelling of some data. The result is stored in
the object Bass.nls. I want to export a matrix with the three
Hello R people,
How can I compute the mean of the Pulse_rate column of the data frame or
matrix from the following character object called str_got. It has 14
entries and each entry has 8 values, separated by commas. Please go thru
the following R commands to know how I tried to unstring and
I will also post the above to the sig mixed models forum now.
Thanks.
--
View this message in context:
http://r.789695.n4.nabble.com/General-question-about-GLMM-and-heterogeneity-of-variance-tp4424429p4431107.html
Sent from the R help mailing list archive at Nabble.com.
Dear all.
I am searching for KMeans ++ for R. I cannot find it.
Do you know any package with it?
Best regards,
Rui
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide
On 29-02-2012, at 09:45, Aniruddha Mukherjee wrote:
Hello R people,
How can I compute the mean of the Pulse_rate column of the data frame or
matrix from the following character object called str_got. It has 14
entries and each entry has 8 values, separated by commas. Please go thru
the
Dear Rui,
What ++ means? There is kmeans in stats package.
Best Regards,
Pascal
Le 29/02/2012 19:20, Rui Esteves a écrit :
Dear all.
I am searching for KMeans ++ for R. I cannot find it.
Do you know any package with it?
Best regards,
Rui
__
Dear Pascal,
From Wikipedia:
In applied statistics, k-means++ is an algorithm for choosing the
initial values (or seeds) for the k-means clustering algorithm. It
was proposed in 2007 by David Arthur and Sergei Vassilvitskii, as an
approximation algorithm for the NP-hard k-means problem—a way of
Dear Rui,
Did you have a look at 'pracma' package? There is a 'kmeanspp' function.
Best Regards,
Pascal
Le 29/02/2012 19:52, Rui Esteves a écrit :
Dear Pascal,
From Wikipedia:
In applied statistics, k-means++ is an algorithm for choosing the
initial values (or seeds) for the k-means
On 29-02-2012, at 11:49, Aniruddha Mukherjee wrote:
Hello Berend.
Many thanks for your prompt reply and that helped me a lot. One more thing,
if you please explain, I shall be highly obliged.
Why in my case (i.e. when stringsAsFactors was TRUE by default),
You can save it as an R Data file using save() and then reload it with
load() -- there's not a natural way to make it something that lives
nicely in a text file (since an nls object is quite complex) -- if you
are just going to be using the object again in R I'd recommend the
first. If you need it
In short, don't -- use a named list instead.
Long answer:
?assign
?get
Michael
On Tue, Feb 28, 2012 at 10:40 PM, michaelyb cel81009...@gmail.com wrote:
Hello,
I am trying to use a for loop to name objects in each iteraction. As in the
following example (which doesn't work quite well)
I don't use Access but my general impression is that the advantages it
brings will be similar to those brought by any other database:
performance rather than ability -- they are both Turing complete after
all, after some trickery on the SQL end.
Databases allow much larger data sets than R
Hello Berend.
Many thanks for your prompt reply and that helped me a lot. One more
thing, if you please explain, I shall be highly obliged.
Why in my case (i.e. when stringsAsFactors was TRUE by default),
as.numeric(matr1$Pulse_rate)
displays the following
[1] 4 5 7 5 9 8 6 10 3 2
Thanks, Dear Petr Savick.
Your help is enough to solve my problem. With your help I've dealt with the
problem.
Many thanks for your effort,
Sincerely,
Helin
--
View this message in context:
http://r.789695.n4.nabble.com/indexing-tp4428210p4431168.html
Sent from the R help mailing list
Hi - Is there a Minimum Curvature interpolation function writen for R
somewhere? Sometimes called minimum Curvature Splines I believe. Have
searched the help-archive etc with no joy.
Many thanks!
--
Dr Paul E Brewin
South Georgia Project Science Officer
Shallow Marine Surveys Group
PO Box
Dear community,
Apologies, I'm still pretty newbie. Anyway, I am performing linar regression
analysis. As a common cause of non-normally distributed residuals is
non-normally predictor variables, i'm interested in achieving the best
transformation of the predictors.
I've seen some commands at
Hi
My dataframe looks like this
data=
id V1 V2 V3 V4
1 5 6 7 8
1 10 20 30 40
2 23 54 54 6
3 43 54 54 33
4 12 34 54 54
4 34 54 23 52
I have to sum by id
I used command aggregate(data,by =list(data$id),FUN=sum)
Error i face is
Error in Summary.factor(c(1L, 1L, 1L, 1L, 1L), na.rm =
Factors are internally stored as integers (enums if you have used
other programming languages) with a special label set -- it's more
memory efficient than storing the whole string over and over.
Michael
On Wed, Feb 29, 2012 at 5:49 AM, Aniruddha Mukherjee
aniruddha.mukher...@tcs.com wrote:
I have a function written for Splus, when I run it in R I obtain get an error
because the function has the elements 0.d0 and 2.d0. How can I change it
to run in R?
The function can be found in page 230 from
http://www.stat.wisc.edu/~mchung/teaching/stat471/stat_computing.pdf
Function is as
Dear James,
The distances are normalized between zero and 1, so in your case all of them
will be zero. You can check that with
res$Dist.for.model
And do
Q.NH(summary(res)[[1]]$beta, x=0)
To obtain the common transition matrix.
Cheers,
Oscar
On 29/2/12 03:59, monkeylan
Dear R gurus,
I'm trying to use jit package to parallel my computing
do you put jit(2) /jit(1) in front of every loops? I got 8 nested loops
in my code.
many thanks
yan
__
R-help@r-project.org mailing list
On 29/02/2012 12:45, R. Michael Weylandt wrote:
I don't use Access but my general impression is that the advantages it
brings will be similar to those brought by any other database:
performance rather than ability -- they are both Turing complete after
all, after some trickery on the SQL end.
Change the name to something syntactically valid? The problem is that
you can't (well, you can, but it's ill advised) have variable names
beginning with numbers. They don't seem to be used much so there
won't be much trouble in that.
Michael
2012/2/29 Freddy Hernández fhern...@gmail.com:
I
The error message is clear: your problem is that your data.frame (note
the period) contains factors. Use str(data) -- also don't use data as
it's a function name -- to see which ones and change as appropriate.
Michael
On Wed, Feb 29, 2012 at 7:16 AM, arunkumar akpbond...@gmail.com wrote:
Hi
On 29-02-2012, at 14:02, Freddy Hernández wrote:
I have a function written for Splus, when I run it in R I obtain get an error
because the function has the elements 0.d0 and 2.d0. How can I change it
to run in R?
The function can be found in page 230 from
That's why I said you need the book. The details are all in the book.
From: Michael [mailto:comtech@gmail.com]
Sent: Thursday, February 23, 2012 1:49 PM
To: Liaw, Andy
Cc: r-help
Subject: Re: [R] Good and modern Kernel Regression package in R with
I wouldn't see myself as an experienced R user soI would appreciate if anyone
is able to give me a clear set of instructions on how to install and load
QRMlib. The steps I've followed are:
1: Download 'QRMlib_1.4.5.1.tar.gz' from
http://cran.r-project.org/src/contrib/Archive/QRMlib/ to my local
On Tue, Feb 28, 2012 at 6:06 PM, Trying To learn again
tryingtolearnag...@gmail.com wrote:
Hi all,
I´m new using Access. I see that many things that you can do on Access you
can do on CRAN R but not on contrary.
My question is: Is there any manual with examples comparing how to do data
base
On 29/02/2012 13:24, R. Michael Weylandt wrote:
Change the name to something syntactically valid? The problem is that
you can't (well, you can, but it's ill advised) have variable names
beginning with numbers. They don't seem to be used much so there
won't be much trouble in that.
I think
On 12-02-29 8:16 AM, R. Michael Weylandt wrote:
Factors are internally stored as integers (enums if you have used
other programming languages) with a special label set -- it's more
memory efficient than storing the whole string over and over.
That was one of the original justifications, but
Well, because QRMlib interfaces C routines (IIRC), the error message is pretty
indicative, i.e. these routines cannot be compiled. Now, without further
information there is not much to recommend, but:
1) check your RTools installation
2) Ask the package maintainer (cc'ed) when he will
I want to right-justify a vector of numbers in the right margin of a
low-level plot. For this I need to compute the line parameter to give to
mtext. Is this the correct scalable calculation?
par(mar=c(4,3,1,5)); plot(1:20)
s - 'abcde'; w=strwidth(s, units='inches')/par('cin')[1]
mtext(s,
Oh...that does make more sense -- seemed like a rather odd choice of
variable name.
Michael
On Wed, Feb 29, 2012 at 8:40 AM, Prof Brian Ripley
rip...@stats.ox.ac.uk wrote:
On 29/02/2012 13:24, R. Michael Weylandt wrote:
Change the name to something syntactically valid? The problem is that
On 29/02/2012 13:41, Duncan Murdoch wrote:
On 12-02-29 8:16 AM, R. Michael Weylandt wrote:
Factors are internally stored as integers (enums if you have used
other programming languages) with a special label set -- it's more
memory efficient than storing the whole string over and over.
That
Dear R users,
I'm a newbie for R and want to ask some basic questions.
So, after I open the R software, I typed library(DAAG). Then, I get massive
warning messages as shown below.
Why does it happen?
Also, here are few specific questions regarding each message.
1) Loading required package:
The build system rolled up R-2.14.2.tar.gz (codename Gift-Getting Season) at
9:00 this morning. This is intended to be the final round-up release of the
2.14 series; see the list below for details.
(The codename is still not part of the actual sources. That feature will have
to wait for
I am currently looking at rugby scores and I have predicted 'T', 'C', 'P' and
'D' by using the predict function for a weekend of results.
score -5*T + 2*C + 3*P+ 3*Dr
score
So the output from the score function above is 12 values, as follows. Where
1 to 12 represent the teams involved in the
Dear R buddies,
Iâm trying to run Principal Component Analysis, package
princomp:
http://stat.ethz.ch/R-manual/R-patched/library/stats/html/princomp.html.
My question is: why do I get different results with pca =
princomp (x, cor = TRUE) and pca = princomp (x, cor = FALSE) even when I
Hi,
On Wed, Feb 29, 2012 at 9:52 AM, Blaz Simcic blazsim...@yahoo.com wrote:
Dear R buddies,
I’m trying to run Principal Component Analysis, package
princomp:
http://stat.ethz.ch/R-manual/R-patched/library/stats/html/princomp.html.
I'm going to assume you actually mean the princomp()
Hi all,
As you can see from below, the result is strange...
I would imagined that the bb result should be much higher and close to 1,
any way to improve the fit?
Any other classification methods?
Thank you!
data=data.frame(y=rep(c(0, 1), times=100), x=1:200)
aa=glm(y~x, data=data,
Dear List i'm performing hierarchical clustering analysis with ward method.
My best clusters are choosen according to silhouette score...
Now I'd like to select the most representative term in each cluster.
Do you think that searching for medoids could be a good idea?
Here is the code that I use
I believe there is also an example of how to select initial values for k-means
in Modern and Applied Statistics with S (Venables and Ripley).
Ken
On 02/29/12, Pascal Oettli wrote:
Dear Rui,
Did you have a look at 'pracma' package? There is a 'kmeanspp' function.
Best Regards,
Pascal
x - data.frame(a=rnorm(100), b=rnorm(100), d=rnorm(100))
prcomp(x, scale=T)
prcomp(scale(x), scale=F)
The above will give you the same thing. This should be the case because
the correlation matrix is the same as the covariance of the scaled and
centered original data.
FWIW
Stephen
On
On Wed, Feb 29, 2012 at 10:02 AM, Michael comtech@gmail.com wrote:
Hi all,
As you can see from below, the result is strange...
Not really.
I would imagined that the bb result should be much higher and close to 1,
any way to improve the fit?
Any other classification methods?
Thank
Do an str() on the data. It looks like temp is a factor and I doubt that
factors can be negative.
John Kane
Kingston ON Canada
-Original Message-
From: svfil...@alaska.edu
Sent: Tue, 28 Feb 2012 22:03:19 -0800 (PST)
To: r-help@r-project.org
Subject: [R] Cannot use negative
How did you see it's non-significant?
Thanks!
On Wed, Feb 29, 2012 at 9:10 AM, Sarah Goslee sarah.gos...@gmail.comwrote:
On Wed, Feb 29, 2012 at 10:02 AM, Michael comtech@gmail.com wrote:
Hi all,
As you can see from below, the result is strange...
Not really.
I would imagined
Formally, look at Pr(|z|). Informally, look at the null and residual
deviances from print(aa).
Michael
On Wed, Feb 29, 2012 at 10:14 AM, Michael comtech@gmail.com wrote:
How did you see it's non-significant?
Thanks!
On Wed, Feb 29, 2012 at 9:10 AM, Sarah Goslee
It all depends on what you are doing but R is pretty powerful. I have never
used Access so I don't know what it can do but I have played around with othe
dbs at a very basic level and most things I did could be done quite easily in R
: Sheer data set size could be a problem but unless you
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
newdata5
$testseq
[1] agtgagatgatagatagatagatagatagatagatagaccagata
Thanks very much for this.
I will try this.
--
View this message in context:
http://r.789695.n4.nabble.com/Export-nls-object-to-text-file-tp4431039p4431752.html
Sent from the R help mailing list archive at Nabble.com.
__
R-help@r-project.org
Dear R users,
I'm a newbie and have another basic question that you guys can answer for
me.
So, I've been noticing that an object (data frame) called FossilFuel is
loaded as default when I first open up the R (see below).
I created this data frame a while ago which is a data set for tutorial and
I
QRMlib built without errors on my WIndows machine. Here's the resulting zip
binary:
http://commondatastorage.googleapis.com/jthetzel-public/QRMlib_1.4.5.1.zip
Will that install on your machine?
Jeremy
DT54321 wrote
I wouldn't see myself as an experienced R user soI would appreciate if
(mydata - as.factor(c(1,2,3, 2, 5, 2)))
str(mydata)
newdata - as.character(mydata)
newdata[newdata==2] - 0
newdata - as.numeric(newdata)
str(newdata)
We really need to keep Excel (and other spreadsheets) out of peoples hands.
John Kane
Kingston ON Canada
-Original Message-
From:
On Wed, Feb 29, 2012 at 1:56 AM, Jochem Schuster jochem.schus...@web.dewrote:
Hello,
thank you very much for your answer. In the following, I will provide my
recent code and try to explain again:
series1 = ts(x$france start=c(2000,1), frequency=4)
series2 = ts(x$germany, start=c(2000,1),
Put
--no-restore
On your startup command to start with a clean session.
On Wednesday, February 29, 2012, Jason Love jason.love1...@gmail.com
wrote:
Dear R users,
I'm a newbie and have another basic question that you guys can answer for
me.
So, I've been noticing that an object (data frame)
Please folks ...
On Wed, Feb 29, 2012 at 7:14 AM, Michael comtech@gmail.com wrote:
How did you see it's non-significant?
You need to take or review a basic statistics course. Pr(|Z|) is your P value.
Thanks!
On Wed, Feb 29, 2012 at 9:10 AM, Sarah Goslee sarah.gos...@gmail.comwrote:
This question sounds more suited for the Bioconductor list which focuses on R
tools for genetic/bioinformatic computation. It's an active and very friendly
list and I think one doesn't have to subscribe to post (but doing so certainly
isn't a bad idea).
Michael
On Feb 29, 2012, at 9:55 AM,
* William Dunlap jqha...@gvopb.pbz [2012-02-28 23:06:54 +]:
You need to walk through the objects, checking for environments on
each component or attribute of an object.
so why doesn't object.size do that?
f - function(n) {
+ d - data.frame(y = rnorm(n), x = rnorm(n))
+ lm(y
On Wed, 2012-02-22 at 10:55 -0800, RHam wrote:
My data set consist of number of calls (lcin) across Day. I am looking for
activity differences between three features (4 sites per feature). I am also
looking for peaks of activity across time (Day). I am using a gamm since I
believe these are
Hi Jason
If you close an R session and save without choosing a filename, a file called
.RData will be created. Open a new session and type getwd(). Then have a look
in the named file with your folder options set to Show Hidden Files. Deleting
or renaming this file should remove the imported
Dear Group,
I have the following dataset:
ID REPI DV CONC SS
11 156.84 116 0
1 2 146.56 116 0
13 115.13 116 0
14 207.81 116 0
15 129.53 116 0
16 151.48 116 0
17 158.95 116 0
18 192.37 116 0
19 32.97 116 0
1 10
I do a lot of strsplit, unlist, subsetting, so I could imagine why
the RSS is triple the total size of my data if all the intermediate
results are not released.
I can only give some generalities about that. Using lots of
small chunks of memory (like short strings) may cause fragmentation
Le mercredi 29 février 2012 à 11:42 -0500, Sam Steingold a écrit :
* William Dunlap jqha...@gvopb.pbz [2012-02-28 23:06:54 +]:
You need to walk through the objects, checking for environments on
each component or attribute of an object.
so why doesn't object.size do that?
f -
I need some real help on this, really stuck
how are the coefficients for
ur.ers(y, type = c(DF-GLS, P-test), model = c(constant, trend),
lag.max = 0)
The max lag is set at zero, so the regression should simply be
Diff(zt) = a*z(t-1)
where a is the value i'm trying to find and z(t)'s are
Dear all,
I have an issue concerning the lme function and I couldn't find the solution
elsewhere.
I have a data frame with id, Ages, Parameter1 and Parameter2.
The Ages can belong to one of two categories early or late.
Then for example an id can have several values of Parameter1 at different
Hello,
Try the following.
(In Andrija's code I've changed 'df' to 'DF', 'df' is a R function name)
DF - read.table( ... etc ...
tc - textConnection(
Column1(Gen)Column2(Name)
A_1 Wynda
A_2 A_2
B_1
That worked!
Thanks a lot Jeremy.
--
View this message in context:
http://r.789695.n4.nabble.com/Installing-package-QRMlib-tp4425269p4431895.html
Sent from the R help mailing list archive at Nabble.com.
__
R-help@r-project.org mailing list
Thank you Michael.
I also wrote to the author of this program, Palph, he suggested the same
thing. It worked!!
It is a very useful tool. In case for someone who is interested, I found the
package here:
http://cran.r-project.org/web/packages/hier.part/
--
View this message in context:
Hi everyone, I was using rattle. I used a database with 4 individuals and
50 variables. Reading the database was OK and that was made by rattle but when
y was trying to draw the tree, rattle shows the image attached.
Please help me.
Raúl Fernández
Hello,
I am extremely new to R and have found some leads to this question in the
archives, but I am still a bit uncertain.
I am looking for an R package to carry out orthogonal distance regression. I
found some answers regarding Deming
regression and Total Least Squares regression, but I was
I am a relatively new R user and have recently built a multivariate dataset
without the demographic information.
Is there any package or code to simulate subgroup dataset (race, sex, age)
using R?
Any help would be appreciated.
Thanks,
Alok
[[alternative HTML version deleted]]
hi all. i'm busy with some time series data, starting from an earlier period
until the current day.
i have created a time series forecast taking into account the entire data
from the earlier date up until 2007, using the forecast package for R. i
am comparing this forecasted data to the actual/
Hello,
sorry i'm an R newbie and wan't to install
ggplot2 on my ubuntu system.
during installation i got the error warning:
Warnmeldung:
In install.packages(reshape) :
Installation des Pakets 'reshape' hatte Exit-Status ungleich 0
Please, give me a idea, how can i fix this error/warning
--
1.0d+0 is Fortran (not C) for a double precision value,
1.0 * 10^0.
1.0e+0 is Fortran for a single precision value, 1.0 * 10^0
and C for a double precision value.
Bill Dunlap
Spotfire, TIBCO Software
wdunlap tibco.com
-Original Message-
From: r-help-boun...@r-project.org
On 29.02.2012 17:36, Raúl Fernández Naranjo wrote:
Hi everyone, I was using rattle. I used a database with 4 individuals and
50 variables. Reading the database was OK and that was made by rattle but when
y was trying to draw the tree, rattle shows the image attached.
And have
On 28.02.2012 07:04, Yashwanth M.R wrote:
Hi Mr. Uwe Ligges,
Yashwanth M.R,
this is the R-help mailing list, not my personal mail account (and Mr.
is inappropriate in any case).
I really thankful for the reply. I even tried the same,
means writing the new function.
On 29.02.2012 18:34, ibid...@gmx.at wrote:
Hello,
sorry i'm an R newbie and wan't to install
ggplot2 on my ubuntu system.
during installation i got the error warning:
Warnmeldung:
In install.packages(reshape) :
Installation des Pakets 'reshape' hatte Exit-Status ungleich 0
Please, give me
On Feb 29, 2012, at 12:34 PM, ibid...@gmx.at wrote:
Hello,
sorry i'm an R newbie and wan't to install
ggplot2 on my ubuntu system.
during installation i got the error warning:
Warnmeldung:
In install.packages(reshape) :
Installation des Pakets 'reshape' hatte Exit-Status ungleich 0
Please,
* Milan Bouchet-Valat anyvzv...@pyho.se [2012-02-29 18:18:50 +0100]:
I think you're simply hitting a (terrible) OS limitation. Linux is
very often not able to reclaim the memory R has used because it's
fragmented. The OS can only get the pages back if nothing is above
them, and most of the
Hi Alok
See ?createCovariates in MSToolkit.
Best wishes
Chris
Chris Campbell
MANGO SOLUTIONS
Data Analysis that Delivers
+44 1249 705450
-Original Message-
From: r-help-boun...@r-project.org [mailto:r-help-boun...@r-project.org] On
Behalf Of Bhupatkar, Alok
Sent: 29 February 2012
From your description, I believe the ladder function in the HH package is
what you are looking for.
## install.packages(HH) ## if necessary
library(HH)
data(tv)
ladder(life.exp ~ ppl.per.phys, data=tv, scales=list(relation=free))
Rich
On Wed, Feb 29, 2012 at 6:21 AM, agent dunham
On Wed, Feb 29, 2012 at 7:53 AM, Adam Waytz
a-wa...@kellogg.northwestern.edu wrote:
Hello,
I am extremely new to R and have found some leads to this question in the
archives, but I am still a bit uncertain.
I am looking for an R package to carry out orthogonal distance regression. I
In the age of google, I have found that concepts such as these are more complex
than what Wikipedia provides. Going far beyond a cursory search, it appeared to
me there are subtle differences between these terms. I was hoping this
knowledgeable community could provide insight on an R package
Dear helpers
I have two data sets saved as vectors (temperature and velocity). Now I need
to take out a span of temperature and its corresponding velocity in the
other vector. How can I achieve that?
I tried to write a function,which takes a vector entry and then decides
wether to delete the
On Wed, Feb 29, 2012 at 11:58:04AM -0500, Ayyappa Chaturvedula wrote:
Dear Group,
I have the following dataset:
ID REPI DV CONC SS
11 156.84 116 0
1 2 146.56 116 0
13 115.13 116 0
14 207.81 116 0
15 129.53 116 0
16 151.48 116 0
Frank,
This can be done directly with a variant of the panel.axis function.
See function panel.axis.right in the HH package. This was provided for me
by David Winsemius in response to my query on this list in October 2011
https://stat.ethz.ch/pipermail/r-help/2011-October/292806.html
The email
On Tue, Feb 28, 2012 at 3:54 PM, Rob James aetiolo...@gmail.com wrote:
I have a dataset that does not include native scores, but only serial
quantile rankings for a set of units.
Clearly these observations are dependent (in that you can't alter one
observation without also altering others).
Hi: I can't find it anywhere on the internet but I have a book that shows
that, as long
as the SVD of the X matrix can be obtained, then the coefficient solution
to TLS ( least angle regression ) is only a function of the eigenvectors.
Therefore, principal components can be used to obtain the
On 02/28/2012 08:13 AM, aishsk wrote:
Hi I am using the ggplot2 package for the volcano plot and I am using the
following code for the same:
g = ggplot(data=data, aes(x=data[11], y=-log10(data[12]), colour=threshold))
+
+ geom_point(alpha=0.4, size=1.75) +
+ opts(legend.position = none) +
+
Hi Ralf,
have you solved your problem?! If so, could you share? I have the same
problem...
Best,
Marcio
On 3/25/10 6:03 PM, Ralf B wrote:
Hi all,
I have simple x/y data from screen recording in a sequence:
number,x,y
1,10,30
1,20,
1,43,110
1,74,18
1,88,112
and would like
My understanding is that TLS, EIV, and orthogonal regression are closely
related but separate concepts.
If you read the 'Talk' at the Wikipedia page referenced below, you will see
that many people have
terminology problems as well.
My take is that TLS is a special case of EIV and orthogonal
I have a large file backed big. matrix, with millions of rows and 20
columns.
The columns contain data that I simply need to tabulate. There are a few
dozen unique
values. and I just want a frequency count
Test code with a small big matrix.
library(bigmemory)
library(bigtabulate)
test -
Thanks all. This is tremendously helpful.
Best,
Adam
On Feb 29, 2012, at 12:58 PM, David Reiner wrote:
My understanding is that TLS, EIV, and orthogonal regression are closely
related but separate concepts.
If you read the 'Talk' at the Wikipedia page referenced below, you will see
On Wed, 29 Feb 2012, Sam Steingold wrote:
* Milan Bouchet-Valat anyvzv...@pyho.se [2012-02-29 18:18:50 +0100]:
I think you're simply hitting a (terrible) OS limitation. Linux is
very often not able to reclaim the memory R has used because it's
fragmented. The OS can only get the pages back if
On 29.02.2012 15:19, Jason Love wrote:
Dear R users,
I'm a newbie for R and want to ask some basic questions.
So, after I open the R software, I typed library(DAAG). Then, I get massive
warning messages as shown below.
Why does it happen?
Also, here are few specific questions regarding
1 - 100 of 167 matches
Mail list logo