Re: [R] odfweave with openOffice 3.2

2010-05-11 Thread Jean lobry
At 15:57 -0400 11/05/10, Max Kuhn wrote: Problems have been reported, such as: https://stat.ethz.ch/pipermail/r-help/2010-May/237577.html but I have not reproduced them. For me it works fine with the results in the above link and with: sessionInfo() R version 2.10.0 RC (2009-10-18 r5016

[R] odfweave with openOffice 3.2

2010-05-11 Thread Jean lobry
Dear list, since I have upgraded openOffice to version 3.2 I have some trouble to open very simple ODT files generated by odfweave: the file is apparently corrupted (but recovery is fine). I have observed this under windows and mac OS 10.4.11 with R 2.10.0, odfWeave_0.7.11, XML_2.6-0, lattice_0.

Re: [R] odfWeave: odt-file damaged

2010-03-17 Thread Jean lobry
Dear all, I'm resurrecting this old post (about 6 monts old, reproduced thereafter) because I have struggled against the same problem and found a solution so that I found it was worth posting for the record. The simple fix when you want to use odfWeave with 7-ZIP as a compressing/decompressing u

Re: [R] stripchart with pch %in% 21:25 with bg

2009-09-24 Thread Jean lobry
stripchart.formula() works for me with your modification to stripchart.default(). Great! But you don't need the 'bordered' pch for that. Indeed, but this may improve lisibility: # n <- 500 x <- rnorm(n) y <- rnorm(n) fac1 <- rep(c("male", "female"), n) fac2 <- rep(c("blue", "red"), each

Re: [R] stripchart with pch %in% 21:25 with bg

2009-09-23 Thread Jean lobry
I think that it's a good idea, although I have rarely made use of pch > 20. This reminds me to pass on a very belated thank-you to the developer(s) who implemented the formula version for stripchart, which I had promised to do myself quite a long time ago. Thanks, folks! Peter Ehlers Hi Peter,

[R] stripchart with pch %in% 21:25 with bg

2009-09-23 Thread Jean lobry
Dear all, consider: ### x <- round(rnorm(50)) stripchart(x, pch = 21, col = "black", bg = "pink", method = "jitter") points(0.5, 1, pch = 21, col = "black", bg = "pink", cex = 2) ### Under R 2.9.0 the points produced by stripchart are not colored, while points() gives the desidered output (mag

Re: [R] motif search

2008-12-11 Thread Jean lobry
Dear Alessia, I am very new to R and wanted to know if there is a package that, given very long nucleotide sequences, searches and identifies short (7-10nt) motifs.. I would like to look for enrichment of certain motifs in genomic sequences. I tried using MEME (not an R package, I know), b

Re: [R] function to compute consensus DNA sequence by plurality?

2008-05-28 Thread Jean lobry
Kim, Is is what you want? tmp <- readLines(textConnection( "TGCATACACCGACAACATCCTCGACGACTACACCTACTACG CGCCTACACCAACGATGTCCTGGACGACTTCTGCTACTACG CGCCTACACCAACGATGTCCTGGACGACTTCTGCTACTACG CGCCTACACCAACGATGTCCTGGACGACTTCTGCTACTACG CGCCTACACCAACGATGTCCTGGACGACTTCTGCTACTACG AGCATACACCGACAACATCCTCGATG

Re: [R] Sweave / Latex per-chapter output

2008-05-21 Thread Jean lobry
Dear Anne-Marie, we had a similar problem to handle the LaTeX book that ships with the seqinr package (http://pbil.univ-lyon1.fr/software/seqinr/seqinr_1_1-5.pdf). Here is basically the approach we have used: o Each book chapter is written first as a LaTeX article produced by Sweaving its cor

Re: [R] R-Logo in \LaTeX

2008-04-07 Thread Jean lobry
>Hmmm, i've downloaded your pdf, and it is clearly ugly at 400%. >I'm talking about the Rlogo.pdf file. E.g. i'm not sure that >it would look good on an A0 poster. Gabor, you're right, I didn't think about the A0 poster case. You will find here a vectorized version of the Rlogo in eps, pdf and sv

Re: [R] R-Logo in \LaTeX

2008-03-07 Thread Jean lobry
Gabor, > this is nice, but > 1) the logo is a bitmap, it is ugly if you resize it Sure, it's a bitmap, but the naked eye resolution is only 100 $\mu$m so that a vectorized solution is overkilling in most common situations IMHO. I have to zoom by a factor 1200% to see some pixellization problems

Re: [R] R-Logo in \LaTeX (Mag. Ferri Leberl)

2008-03-07 Thread Jean lobry
Dear Mag. Ferri Leberl, I'm using something like: --- tex.tex --- \documentclass{article} \usepackage{graphicx} \usepackage{fancyvrb} \newcommand{\Rlogo}{\protect\includegraphics[height=1.8ex,keepaspectratio]{Rlogo.pdf}} \newcommand{\myinput}[1] {\begin

Re: [R] How to include the documentation of a function in a Sweave document?

2008-02-26 Thread Jean lobry
Dear all, thanks for your suggestions. I like the idea of including directly the LaTeX file corresponding to the targeted topic, however, my understanding from the reading of ?help is that these LaTeX files are not always available, depending on the build of R. I found a solution that works well

[R] How to include the documentation of a function in a Sweave document?

2008-02-25 Thread Jean lobry
Dear R-help, I would like to include the documentation of an R function in an *.rnw document processed by Sweave. Because I'm sharing my *.rnw files with colleagues under Linux and Windows (I'm on Mac OS X), I would like a pure R solution. The naive approach doesn't work, because Sweaving this *.

Re: [R] [OT] vernacular names for circular diagrams

2008-01-29 Thread Jean lobry
> > On Mon, 28 Jan 2008 13:38:51 -0600, Roger Koenker wrote: > > Howard Wainer (Graphical Discovery, PUP, 2005, p 20) gives > this dubious honor to Playfair (1759- 1823). Nightingale (1820- > 1910) was far too enlightened for this sort of thing, see for example > her letter to Galton about

Re: [R] [OT] vernacular names for circular diagrams

2008-01-27 Thread Jean lobry
>Nice. Two minor points: > >- the illustration for Danish has a cake which is speaking Polish > >- "Stastistical" (on the ISI page) > Ooops! I have changed the picture and fixed the typo, Thanks. -- Jean R. Lobry([EMAIL PROTECTED]) Laboratoire BBE-CNRS-UMR-5558, Univ. C. Bernard -

Re: [R] [OT] vernacular names for circular diagrams

2008-01-27 Thread Jean lobry
> Dear useRs, > > by a circular diagram representation I mean what you will get by entering > this at your R promt: > > pie(1:5) > > Nice to have R as a lingua franca :-) > > The folowing quote is from page 360 in this very interesting paper: > > @article{SpenceI2005, > title = {No Hum

Re: [R] How to import ENSEMBL text data using R

2008-01-01 Thread Jean lobry
Dear Anisah, ENSEMBL data are at your hand under R: > library(seqinr) > choosebank("ensembl") > cat(banknameSocket$details, sep = "\n") ACNUC Data Base Content Ensembl Release 47 Last Updated: Dec 12, 2007 76,798,685,993 bases; 3,138,133 s

[R] [OT] vernacular names for circular diagrams

2007-12-12 Thread Jean lobry
Dear useRs, by a circular diagram representation I mean what you will get by entering this at your R promt: pie(1:5) Nice to have R as a lingua franca :-) The folowing quote is from page 360 in this very interesting paper: @article{SpenceI2005, title = {No Humble Pie: The Origins and Usag

Re: [R] visualizing nucleotide sequence properties

2007-11-28 Thread Jean lobry
>Hi there, > >I am looking for R-packages that can help me visualize properties on >nucleotide sequences. I want to display sequences in the 1-100K base range >as lines and plot features above and below those lines. > >Any ideas would be welcome. > >Thanks, > >Bernd Hi Bernd, not sure to understa

Re: [R] Sweave and ggplot2

2007-09-24 Thread Jean lobry
Dear Julien, > Hi, > > I am trying to use ggplot2 graphics with Sweave, but I got problems > with transparency support when generating pdf figures, even if I > specify a ?pdf.version? argument in Sweave options. > [...snip...] I wanted to help because I'm interested by the exploitation of the

Re: [R] Data manipulations with numbers which are in 'comma' format

2007-09-24 Thread Jean lobry
Dear Shubha, > May be a trivial question, but struggling to find a solution... > > v=data.frame(a=c("1,234","2,345","5,567")) > >> v > > a > 11,234 > 22,345 > 35,567 > > I need a column 'b', which is just the addition of column 'a' with 5. > How do I do it? And, entries