[aroma.affymetrix] Re: what kind of file
That's really strange! I mean by the file seems fine that I can see the content of the file, which looks like this: cat MoGene-1_0-st-v1.probe.tab |head Probe IDTranscript Cluster ID probe x probe y assemblyseqname start stopstrand probe sequence target strandedness category 271822 10344614921 258 build-36/mm8chr13044331 3044355 + GGGCTCAAATTCACCTGTGTTAACT Sense main 866088 10344614887 824 build-36/mm8chr13044334 3044358 + AGCTCAAATTCACCTGTGTTA Sense main 240008 10344614607 228 build-36/mm8chr13044335 3044359 + GAGCTCAAATTCACCTGTGTT Sense main 34772 10344614121 33 build-36/mm8chr13044336 3044360 + GGAGCTCAAATTCACCTGTGT Sense main 396933 1034461432 378 build-36/mm8chr13044337 3044361 + GGGAGCTCAAATTCACCTGTG Sense main 613322 10344614121 584 build-36/mm8chr13044504 3044528 + AAGGCTTGGGCTATGCGCTCTCCAG Sense main 984143 10344614292 937 build-36/mm8chr13044557 3044581 + AAGGTCCTCGCTCCTCTTTCATATA Sense main 826914 10344614563 787 build-36/mm8chr13044558 3044582 + GAAGGTCCTCGCTCCTCTTTCATAT Sense main 1075207 103446146 1024build-36/mm8chr13044559 3044583 + GGAAGGTCCTCGCTCCTCTTTCATA Sense main The zip file is 22 MB, the unzipped file is 85.8 MB. file.info(MoGene-1_0-st-v1.probe.tab) returns following: file.info(MoGene-1_0-st-v1.probe.tab) size isdir mode mtime ctime atime uid gid uname MoGene-1_0-st-v1.probe.tab NANA NA NA NA NA NA NA NA grname MoGene-1_0-st-v1.probe.tab NA Any ideas on this issue? Thx, Daniela On Apr 1, 9:31 pm, Mark Robinson mrobin...@wehi.edu.au wrote: Hi Daniela. That's strange. And no, these files do not need to be in a particular directory (In fact, this error is completely independent of the aroma.affmetrix package). The error you get suggests the file is empty. When you say it seems to be fine, what does that mean? Alternatively, what does this give: file.info(MoGene-1_0-st-v1.probe.tab) This should be a decent sized file. The ZIP file that you get from Affymetrix is 23MB, so unzipped it will be a lot larger. Cheers, Mark So far I have managed to nearly run everything of the script. I do though have issues in loading the probe sequences. Do the files need to be stored in a particular folder? For now I have it in ./annotationData/chipTypes/ as I have seen someone else in this forum doing it like this. What else could the reason be? probetab-read.table(MoGene-1_0-st-v1.probe.tab, sep=\t,header=TRUE, comment.char=,stringsAsFactors=FALSE) Error in read.table(MoGene-1_0-st-v1.probe.tab, sep = \t, header = TRUE, : no lines available in input I double checked the file I downloaded from Affy and it seems to be fine! Thx, Daniela On Mar 16, 4:56 pm, Mark Robinson mrobin...@wehi.edu.au wrote: Hi Daniela. Those files are available from Affymetrix. For example, see:http://www.affymetrix.com/estore/browse/products.jsp?productId=131453... HuGene-1_0-st-v1 Transcript Cluster Annotations, CSV, Release 30 (18 MB 11/09/09) HuGene-1_0-st-v1 Probe Sequences, tabular format (22 MB 07/13/07) (there are different versions of the annotation files available) Cheers, Mark On 13-Mar-10, at 8:12 AM, dkny169 wrote: Hello, I am working on the sup3.R script (FIRMAGene). I was wondering what kind of files these are: HuGene-1_0-st- v1.na25.hg18.transcript.csv and HuGene-1_0-st-v1.probe.tab? What is in these files? What am I supposed to load here into FIRMAGene? Thanks a lot! -- When reporting problems on aroma.affymetrix, make sure 1) to run the latest version of the package, 2) to report the output of sessionInfo() and traceback(), and 3) to post a complete code example. You received this message because you are subscribed to the Google Groups aroma.affymetrix group. To post to this group, send email to aroma-affymetrix@googlegroups.com To unsubscribe from this group, send email to aroma-affymetrix-unsubscr...@googlegroups.com For more options, visit this group athttp://groups.google.com/group/aroma-affymetrix?hl=en -- Mark Robinson, PhD (Melb) Epigenetics Laboratory, Garvan Bioinformatics Division, WEHI e: m.robin...@garvan.org.au e: mrobin...@wehi.edu.au p: +61 (0)3 9345 2628 f: +61 (0)3 9347 0852 -- __ The information in this email is confidential and intended solely for the addressee. You must not disclose, forward, print or use it without the permission of the sender
[aroma.affymetrix] Re: what kind of file
So far I have managed to nearly run everything of the script. I do though have issues in loading the probe sequences. Do the files need to be stored in a particular folder? For now I have it in ./annotationData/chipTypes/ as I have seen someone else in this forum doing it like this. What else could the reason be? probetab-read.table(MoGene-1_0-st-v1.probe.tab, sep=\t,header=TRUE, comment.char=,stringsAsFactors=FALSE) Error in read.table(MoGene-1_0-st-v1.probe.tab, sep = \t, header = TRUE, : no lines available in input I double checked the file I downloaded from Affy and it seems to be fine! Thx, Daniela On Mar 16, 4:56 pm, Mark Robinson mrobin...@wehi.edu.au wrote: Hi Daniela. Those files are available from Affymetrix. For example, see:http://www.affymetrix.com/estore/browse/products.jsp?productId=131453... HuGene-1_0-st-v1 Transcript Cluster Annotations, CSV, Release 30 (18 MB 11/09/09) HuGene-1_0-st-v1 Probe Sequences, tabular format (22 MB 07/13/07) (there are different versions of the annotation files available) Cheers, Mark On 13-Mar-10, at 8:12 AM, dkny169 wrote: Hello, I am working on the sup3.R script (FIRMAGene). I was wondering what kind of files these are: HuGene-1_0-st- v1.na25.hg18.transcript.csv and HuGene-1_0-st-v1.probe.tab? What is in these files? What am I supposed to load here into FIRMAGene? Thanks a lot! -- When reporting problems on aroma.affymetrix, make sure 1) to run the latest version of the package, 2) to report the output of sessionInfo() and traceback(), and 3) to post a complete code example. You received this message because you are subscribed to the Google Groups aroma.affymetrix group. To post to this group, send email to aroma-affymetrix@googlegroups.com To unsubscribe from this group, send email to aroma-affymetrix-unsubscr...@googlegroups.com For more options, visit this group athttp://groups.google.com/group/aroma-affymetrix?hl=en -- Mark Robinson, PhD (Melb) Epigenetics Laboratory, Garvan Bioinformatics Division, WEHI e: m.robin...@garvan.org.au e: mrobin...@wehi.edu.au p: +61 (0)3 9345 2628 f: +61 (0)3 9347 0852 -- __ The information in this email is confidential and intended solely for the addressee. You must not disclose, forward, print or use it without the permission of the sender. __ -- When reporting problems on aroma.affymetrix, make sure 1) to run the latest version of the package, 2) to report the output of sessionInfo() and traceback(), and 3) to post a complete code example. You received this message because you are subscribed to the Google Groups aroma.affymetrix group with website http://www.aroma-project.org/. To post to this group, send email to aroma-affymetrix@googlegroups.com To unsubscribe from this group, send email to aroma-affymetrix-unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/aroma-affymetrix?hl=en To unsubscribe, reply using remove me as the subject.
[aroma.affymetrix] Re: FIRMAGene command
Unfortunately I cannot get to the docs, unless the same docs are stored under help.start() I used following parameters: plm - RmaPlm(csNU) plm [1] RmaPlm: 0x22388540 cls-gsub(TisMap_,,gsub(_0(1-3)_v1_WTGene1,,getNames(cs))) cls [1] P.L_10 P.L_11 P.L_12 P.L_14 P.L_15 P.L_16 P.L_2 P.L_3 [9] P.L_4 P.L_5 P.L_6 P.L_7 P.L_8 P.L_9 I am not sure what is supposed to be stored in cls and u. I’m a bit confused however, with what the whole “unique cdf set” is for and how plm is working. Can I save the plm data into a txt file? Many thanks for your help. I really appreciate it. Daniela On Mar 16, 4:57 pm, Mark Robinson mrobin...@wehi.edu.au wrote: Hi Daniela. You haven't told us what inputs you've used for 'plm' and 'cls' ... and what is stored in 'u'? Have you read the docs at: ?FIRMAGene Cheers, Mark On 14-Mar-10, at 10:21 AM, dkny169 wrote: Hello, I have a question regarding FIRMAGene. Executing the FIRMAGene command I get the following error: fg-FIRMAGene(plm, idsToUse=u, cls=cls) Gathering/calculating residuals. Reading units. Error in if (any(units 1)) stop(Argument 'units' contains non- positive indices.) : missing value where TRUE/FALSE needed The commands used right before are: monetaffx-read.csv(MoEx-1_0-st-v1.na29.mm9.transcript.csv, sep=,,skip=20, header=TRUE,comment.char=,stringsAsFactors=FALSE) probetab-read.table(MoEx-1_0-st-v1.na29.mm9.probeset.csv, sep=\t, header=TRUE, comment.char=, stringsAsFactors=FALSE) u-which(getUnitNames(cdf) %in% monetaffx$probeset_id [monetaffx $category ==main monetaffx$total_probes 7 monetaffx $total_probes 200]) I'm not sure what these commands do and how they need to be changed to accommodate my own data: cls - gsub(TisMap_,,gsub(_0[1-3]_v1_WTGene1,,getNames(cs))) Many thanks, Daniela -- When reporting problems on aroma.affymetrix, make sure 1) to run the latest version of the package, 2) to report the output of sessionInfo() and traceback(), and 3) to post a complete code example. You received this message because you are subscribed to the Google Groups aroma.affymetrix group. To post to this group, send email to aroma-affymetrix@googlegroups.com To unsubscribe from this group, send email to aroma-affymetrix-unsubscr...@googlegroups.com For more options, visit this group athttp://groups.google.com/group/aroma-affymetrix?hl=en -- Mark Robinson, PhD (Melb) Epigenetics Laboratory, Garvan Bioinformatics Division, WEHI e: m.robin...@garvan.org.au e: mrobin...@wehi.edu.au p: +61 (0)3 9345 2628 f: +61 (0)3 9347 0852 -- __ The information in this email is confidential and intended solely for the addressee. You must not disclose, forward, print or use it without the permission of the sender. __ -- When reporting problems on aroma.affymetrix, make sure 1) to run the latest version of the package, 2) to report the output of sessionInfo() and traceback(), and 3) to post a complete code example. You received this message because you are subscribed to the Google Groups aroma.affymetrix group. To post to this group, send email to aroma-affymetrix@googlegroups.com To unsubscribe from this group, send email to aroma-affymetrix-unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/aroma-affymetrix?hl=en
[aroma.affymetrix] Re: FIRMAGene command
I definitely loaded the package and had a look at the help.start docs. Neverthelss, I wasn't able to work out my problems that I described in my previous post. On Mar 18, 1:58 pm, Henrik Bengtsson henrik.bengts...@gmail.com wrote: Hi. On Thu, Mar 18, 2010 at 6:47 PM, dkny169 daniela...@yahoo.com wrote: Unfortunately I cannot get to the docs, unless the same docs are stored under help.start() Please explain what the problem/error is. Note that you have to load a package in order to use ?/help() on its methods, e.g. library(FIRMAGene); ?FIRMAGene If you don't load it, you get something like: ?FIRMAGene No documentation for 'FIRMAGene' in specified packages and libraries: you could try '??FIRMAGene' The help is the same regardless if you access it via ?/help() or help.start(). So, yes, you'll find the same information if you do help.start() - Packages - FIRMAGene - FIRMAGene /Henrik I used following parameters: plm - RmaPlm(csNU) plm [1] RmaPlm: 0x22388540 cls-gsub(TisMap_,,gsub(_0(1-3)_v1_WTGene1,,getNames(cs))) cls [1] P.L_10 P.L_11 P.L_12 P.L_14 P.L_15 P.L_16 P.L_2 P.L_3 [9] P.L_4 P.L_5 P.L_6 P.L_7 P.L_8 P.L_9 I am not sure what is supposed to be stored in cls and u. I’m a bit confused however, with what the whole “unique cdf set” is for and how plm is working. Can I save the plm data into a txt file? Many thanks for your help. I really appreciate it. Daniela On Mar 16, 4:57 pm, Mark Robinson mrobin...@wehi.edu.au wrote: Hi Daniela. You haven't told us what inputs you've used for 'plm' and 'cls' ... and what is stored in 'u'? Have you read the docs at: ?FIRMAGene Cheers, Mark On 14-Mar-10, at 10:21 AM, dkny169 wrote: Hello, I have a question regarding FIRMAGene. Executing the FIRMAGene command I get the following error: fg-FIRMAGene(plm, idsToUse=u, cls=cls) Gathering/calculating residuals. Reading units. Error in if (any(units 1)) stop(Argument 'units' contains non- positive indices.) : missing value where TRUE/FALSE needed The commands used right before are: monetaffx-read.csv(MoEx-1_0-st-v1.na29.mm9.transcript.csv, sep=,,skip=20, header=TRUE,comment.char=,stringsAsFactors=FALSE) probetab-read.table(MoEx-1_0-st-v1.na29.mm9.probeset.csv, sep=\t, header=TRUE, comment.char=, stringsAsFactors=FALSE) u-which(getUnitNames(cdf) %in% monetaffx$probeset_id [monetaffx $category ==main monetaffx$total_probes 7 monetaffx $total_probes 200]) I'm not sure what these commands do and how they need to be changed to accommodate my own data: cls - gsub(TisMap_,,gsub(_0[1-3]_v1_WTGene1,,getNames(cs))) Many thanks, Daniela -- When reporting problems on aroma.affymetrix, make sure 1) to run the latest version of the package, 2) to report the output of sessionInfo() and traceback(), and 3) to post a complete code example. You received this message because you are subscribed to the Google Groups aroma.affymetrix group. To post to this group, send email to aroma-affymetrix@googlegroups.com To unsubscribe from this group, send email to aroma-affymetrix-unsubscr...@googlegroups.com For more options, visit this group athttp://groups.google.com/group/aroma-affymetrix?hl=en -- Mark Robinson, PhD (Melb) Epigenetics Laboratory, Garvan Bioinformatics Division, WEHI e: m.robin...@garvan.org.au e: mrobin...@wehi.edu.au p: +61 (0)3 9345 2628 f: +61 (0)3 9347 0852 -- __ The information in this email is confidential and intended solely for the addressee. You must not disclose, forward, print or use it without the permission of the sender. __ -- When reporting problems on aroma.affymetrix, make sure 1) to run the latest version of the package, 2) to report the output of sessionInfo() and traceback(), and 3) to post a complete code example. You received this message because you are subscribed to the Google Groups aroma.affymetrix group. To post to this group, send email to aroma-affymetrix@googlegroups.com To unsubscribe from this group, send email to aroma-affymetrix-unsubscr...@googlegroups.com For more options, visit this group athttp://groups.google.com/group/aroma-affymetrix?hl=en -- When reporting problems on aroma.affymetrix, make sure 1) to run the latest version of the package, 2) to report the output of sessionInfo() and traceback(), and 3) to post a complete code example. You received this message because you are subscribed to the Google Groups aroma.affymetrix group. To post to this group, send email to aroma-affymetrix@googlegroups.com To unsubscribe from this group, send email to aroma-affymetrix-unsubscr...@googlegroups.com For more options, visit this group at http
[aroma.affymetrix] FIRMAGene command
Hello, I have a question regarding FIRMAGene. Executing the FIRMAGene command I get the following error: fg-FIRMAGene(plm, idsToUse=u, cls=cls) Gathering/calculating residuals. Reading units. Error in if (any(units 1)) stop(Argument 'units' contains non- positive indices.) : missing value where TRUE/FALSE needed The commands used right before are: monetaffx-read.csv(MoEx-1_0-st-v1.na29.mm9.transcript.csv, sep=,,skip=20, header=TRUE,comment.char=,stringsAsFactors=FALSE) probetab-read.table(MoEx-1_0-st-v1.na29.mm9.probeset.csv, sep=\t, header=TRUE, comment.char=, stringsAsFactors=FALSE) u-which(getUnitNames(cdf) %in% monetaffx$probeset_id [monetaffx$category ==main monetaffx$total_probes 7 monetaffx$total_probes 200]) I'm not sure what these commands do and how they need to be changed to accommodate my own data: cls - gsub(TisMap_,,gsub(_0[1-3]_v1_WTGene1,,getNames(cs))) Many thanks, Daniela -- When reporting problems on aroma.affymetrix, make sure 1) to run the latest version of the package, 2) to report the output of sessionInfo() and traceback(), and 3) to post a complete code example. You received this message because you are subscribed to the Google Groups aroma.affymetrix group. To post to this group, send email to aroma-affymetrix@googlegroups.com To unsubscribe from this group, send email to aroma-affymetrix-unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/aroma-affymetrix?hl=en
[aroma.affymetrix] what kind of file
Hello, I am working on the sup3.R script (FIRMAGene). I was wondering what kind of files these are: HuGene-1_0-st- v1.na25.hg18.transcript.csv and HuGene-1_0-st-v1.probe.tab? What is in these files? What am I supposed to load here into FIRMAGene? Thanks a lot! -- When reporting problems on aroma.affymetrix, make sure 1) to run the latest version of the package, 2) to report the output of sessionInfo() and traceback(), and 3) to post a complete code example. You received this message because you are subscribed to the Google Groups aroma.affymetrix group. To post to this group, send email to aroma-affymetrix@googlegroups.com To unsubscribe from this group, send email to aroma-affymetrix-unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/aroma-affymetrix?hl=en
[aroma.affymetrix] Re: can't load CDF file
Hi Henrik,
The upload of the cdf file worked now perfectly. Thanks for pointing
out the right version of the supplementary file.
Unfortunately, the upload of the .CEL files still doesn't work? Any
ideas?
cs-AffymetrixCelSet$byName(tissues,cdf=cdf)
Error in list(`AffymetrixCelSet$byName(tissues, cdf = cdf)` =
environment, :
[2010-03-10 13:20:35] Exception: Could not locate a file for this chip
type: MoGene-1_0-st-v1
at throw(Exception(...))
at throw.default(The specified CDF structure (', getChipType(cdf),
') is no
at throw(The specified CDF structure (', getChipType(cdf), ') is
not compat
at setCdf.AffymetrixCelSet(set, cdf)
at setCdf(set, cdf)
at byPath.AffymetrixCelSet(static, path = path, cdf = cdf, ...)
at byPath(static, path = path, cdf = cdf, ...)
at withCallingHandlers(expr, warning = function(w)
invokeRestart(muffleWarnin
at suppressWarnings({
at method(static, ...)
at AffymetrixCelSet$byName(tissues, cdf = cdf)
Many thanks,
Daniela
On Mar 9, 5:12 pm, Henrik Bengtsson henrik.bengts...@gmail.com
wrote:
Hi.
On Tue, Mar 9, 2010 at 11:01 PM, dkny169 daniela...@yahoo.com wrote:
Hi Henrik,
I got my documentation from
here:http://bioinf.wehi.edu.au/folders/firmagene/sup3.R
Thanks. That is from the FIRMAGene supplementary materials:
http://bioinf.wehi.edu.au/folders/firmagene/
Mark provides a more up-to-date version:
[04-Feb-2010] Made a modification to the sup3.R script, now available
as sup3_04feb2010.R, to make sure we use the Ensembl annotation that
corresponds to the hg18 (Mar 2006) build.
Mark, would you mind making it more clear on the above URL that
'sup3.R' is out dated? Reversing the NEWS list so that the most
recent events are at the top may help too. Maybe also by renaming the
outdated one sup3.R to sup3_06jun2009.R.
If you could give me a link to a vignette or manual on how to use
FIRMAGene, which is up to date and understandable, I would be more
than thankful!
More comments below...
Many thanks,
Daniela
On Mar 9, 4:56 pm, Henrik Bengtsson henrik.bengts...@gmail.com
wrote:
Hi,
please let us know what your source of documentation is, e.g.
webpages, because you are using method names that are either outdated
or non-public. Then I'll answer your questions...
/Henrik
On Tue, Mar 9, 2010 at 10:44 PM, dkny169 daniela...@yahoo.com wrote:
Hi Mark,
Thanks for your answer. I think it works now; I had the working
directory set at chipTypes and not at the parent directory of
annotationData.
I am getting following back:
cdf-AffymetrixCdfFile$findByChipType(MoEx-1_0-st-v1)
cdf
[1] annotationData/chipTypes/MoEx-1_0-st-v1/MoEx-1_0-st-v1.cdf
Don't use findByChipType(), which only returns a pathname, but
byChipType(), which returns an AffymetrixCdfFile object, i.e.
cdf - AffymetrixCdfFile$byChipType(MoEx-1_0-st-v1);
[You did this in your first email, but then all of a sudden
findByChipType(), which is why I wondered where you got that from.]
I am trying to upload the CEL files now that are stored in rawData/
tissues/MoEx-1_0-st-v1. The working directory is set at the parent
directory of rawData. But again I am getting a failure message. What
am I doing wrong now?
cs-AffymetrixCelSet$fromName(tissues,cdf=cdf)
Error in list(`AffymetrixCelSet$fromName(tissues, cdf = cdf)` =
environment, :
[2010-03-09 16:28:12] Exception: AffymetrixCelSet$fromName() is
defunct. Use AffymetrixCelSet$byName() instead.
This error message is clear, ehe?
at throw(Exception(...))
at throw.default(msg)
at throw(msg)
at method(static, ...)
at AffymetrixCelSet$fromName(tissues, cdf = cdf)
cs-AffymetrixCelSet$byName(tissues,cdf=cdf)
Error in list(`AffymetrixCelSet$byName(tissues, cdf = cdf)` =
environment, :
[2010-03-09 16:38:21] Exception: Argument 'cdf' is neither of nor
inherits class AffymetrixCdfFile: character
This one is because you used findByChipType() above; use byChipType()
and it will work.
Hope this helps
Henrik
at throw(Exception(...))
at throw.default(sprintf(Argument '%s' is neither of nor inherits
class %s: %
at throw(sprintf(Argument '%s' is neither of nor inherits class %s:
%s, .nam
at method(static, ...)
at Arguments$getInstanceOf(cdf, AffymetrixCdfFile)
at method(static, ...)
at AffymetrixCelSet$byName(tissues, cdf = cdf)
Thanks,
Daniela
On Mar 9, 3:23 pm, Mark Robinson mrobin...@wehi.edu.au wrote:
Hi Daniela.
Is your CDF in the:
annotationData/chipTypes/MoEx-1_0-st-v1/
directory?
(http://aroma-project.org/node/66)
Cheers,
Mark
Hi,
I stored my CDF file in annotationData/chipTypes; nevertheless I
cannot
upload the file.
Can anyone please tel me what I am doing wrong:
cdf-AffymetrixCdfFile$byChipType(MoEx-1_0-st-v1.cdf)
ror in list(`AffymetrixCdfFile$byChipType(MoEx-1_0-st-v1.cdf)` =
environment, :
[2010-03
[aroma.affymetrix] Re: can't load CDF file
Hi Mark, Thanks for your answer. I think it works now; I had the working directory set at chipTypes and not at the parent directory of annotationData. I am getting following back: cdf-AffymetrixCdfFile$findByChipType(MoEx-1_0-st-v1) cdf [1] annotationData/chipTypes/MoEx-1_0-st-v1/MoEx-1_0-st-v1.cdf I am trying to upload the CEL files now that are stored in rawData/ tissues/MoEx-1_0-st-v1. The working directory is set at the parent directory of rawData. But again I am getting a failure message. What am I doing wrong now? cs-AffymetrixCelSet$fromName(tissues,cdf=cdf) Error in list(`AffymetrixCelSet$fromName(tissues, cdf = cdf)` = environment, : [2010-03-09 16:28:12] Exception: AffymetrixCelSet$fromName() is defunct. Use AffymetrixCelSet$byName() instead. at throw(Exception(...)) at throw.default(msg) at throw(msg) at method(static, ...) at AffymetrixCelSet$fromName(tissues, cdf = cdf) cs-AffymetrixCelSet$byName(tissues,cdf=cdf) Error in list(`AffymetrixCelSet$byName(tissues, cdf = cdf)` = environment, : [2010-03-09 16:38:21] Exception: Argument 'cdf' is neither of nor inherits class AffymetrixCdfFile: character at throw(Exception(...)) at throw.default(sprintf(Argument '%s' is neither of nor inherits class %s: % at throw(sprintf(Argument '%s' is neither of nor inherits class %s: %s, .nam at method(static, ...) at Arguments$getInstanceOf(cdf, AffymetrixCdfFile) at method(static, ...) at AffymetrixCelSet$byName(tissues, cdf = cdf) Thanks, Daniela On Mar 9, 3:23 pm, Mark Robinson mrobin...@wehi.edu.au wrote: Hi Daniela. Is your CDF in the: annotationData/chipTypes/MoEx-1_0-st-v1/ directory? (http://aroma-project.org/node/66) Cheers, Mark Hi, I stored my CDF file in annotationData/chipTypes; nevertheless I cannot upload the file. Can anyone please tel me what I am doing wrong: cdf-AffymetrixCdfFile$byChipType(MoEx-1_0-st-v1.cdf) ror in list(`AffymetrixCdfFile$byChipType(MoEx-1_0-st-v1.cdf)` = environment, : [2010-03-09 14:50:58] Exception: Could not locate a file for this chip type: MoEx-1_0-st-v1.cdf at throw(Exception(...)) at throw.default(Could not locate a file for this chip type: , paste(c(chipT at throw(Could not locate a file for this chip type: , paste(c(chipType, tag at method(static, ...) at AffymetrixCdfFile$byChipType(MoEx-1_0-st-v1.cdf) Many thanks for your help! -- When reporting problems on aroma.affymetrix, make sure 1) to run the latest version of the package, 2) to report the output of sessionInfo() and traceback(), and 3) to post a complete code example. You received this message because you are subscribed to the Google Groups aroma.affymetrix group. To post to this group, send email to aroma-affymetrix@googlegroups.com To unsubscribe from this group, send email to aroma-affymetrix-unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/aroma-affymetrix?hl=en __ The information in this email is confidential and intended solely for the addressee. You must not disclose, forward, print or use it without the permission of the sender. __ -- When reporting problems on aroma.affymetrix, make sure 1) to run the latest version of the package, 2) to report the output of sessionInfo() and traceback(), and 3) to post a complete code example. You received this message because you are subscribed to the Google Groups aroma.affymetrix group. To post to this group, send email to aroma-affymetrix@googlegroups.com To unsubscribe from this group, send email to aroma-affymetrix-unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/aroma-affymetrix?hl=en
