Bug#1018863: wordpress: 6.0.2 Security and Maintenance Release

[Salvatore Bonaccorso]

Source: wordpress
Version: 6.0+dfsg1-1
Severity: grave
Tags: security upstream
X-Debbugs-Cc: car...@debian.org, Debian Security Team 

Hi

From
https://wordpress.org/news/2022/08/wordpress-6-0-2-security-and-maintenance-release/
there is a security and maintenance release for 6.0.x.

Do the issues affect as well older series?

Regards,
Salvatore

Bug#1018862: thunar: Double Click (double tap via touchscreen) failed to activate items during Icon View and Compact View

[Vinayak Kulkarni]

Package: thunar
Version: 4.16.8-1
Severity: critical
Tags: upstream
Justification: breaks unrelated software
X-Debbugs-Cc: vinayak_kulka...@mentor.com

Dear Maintainer,

*** Reporter, please consider answering these questions, where appropriate ***

   * What led up to the situation? - Double tap via touchscreen interfaces to 
activate items fails in Stable, Experimental version of upstream
   * What exactly did you do (or not do) that was effective (or
 ineffective)?
   * What was the outcome of this action?
   * What outcome did you expect instead? Expected to activate items or open 
files and folder upon double tap for touchscreen interfaces.
 [These issue was not seen with bullseye 1.6.11 version] 

*** End of the template - remove these template lines ***


-- System Information:
Debian Release: 11.4
  APT prefers stable-updates
  APT policy: (500, 'stable-updates'), (500, 'stable-security'), (500, 'stable')
Architecture: amd64 (x86_64)

Kernel: Linux 5.10.0-14-amd64 (SMP w/8 CPU threads)
Locale: LANG=en_US.UTF-8, LC_CTYPE=en_US.UTF-8 (charmap=UTF-8), LANGUAGE not set
Shell: /bin/sh linked to /usr/bin/dash
Init: systemd (via /run/systemd/system)
LSM: AppArmor: enabled

Versions of packages thunar depends on:
ii  desktop-file-utils   0.26-1
ii  exo-utils4.16.0-1+deb11u1
ii  libatk1.0-0  2.36.0-2
ii  libc62.31-13+deb11u3
ii  libcairo21.16.0-5
ii  libexo-2-0   4.16.0-1+deb11u1
ii  libgdk-pixbuf-2.0-0  2.42.2+dfsg-1
ii  libglib2.0-0 2.66.8-1
ii  libgtk-3-0   3.24.24-4+deb11u2
ii  libgudev-1.0-0   234-1
ii  libice6  2:1.0.10-1
ii  libnotify4   0.7.9-3
ii  libpango-1.0-0   1.46.2-3
ii  libsm6   2:1.2.3-1
ii  libthunarx-3-0   4.16.8-1
ii  libxfce4ui-2-0   4.16.0-1
ii  libxfce4util74.16.0-1
ii  libxfconf-0-34.16.0-2
ii  shared-mime-info 2.0-1
ii  thunar-data  4.16.8-1

Versions of packages thunar recommends:
ii  dbus-user-session [default-dbus-session-bus]  1.12.20-2
ii  dbus-x11 [dbus-session-bus]   1.12.20-2
ii  gnome-shell [polkit-1-auth-agent] 3.38.6-1~deb11u1
ii  gvfs  1.46.2-1
ii  libxfce4panel-2.0-4   4.16.2-1
ii  thunar-volman 4.16.0-1
ii  tumbler   4.16.0-1
ii  udisks2   2.9.2-2+deb11u1
ii  xdg-user-dirs 0.17-2

Versions of packages thunar suggests:
ii  gvfs-backends 1.46.2-1
pn  thunar-archive-plugin 
pn  thunar-media-tags-plugin  

-- no debconf information

Bug#1013872: salt: CVE-2022-22967

[Paul Gevers]

Hi,

On Sun, 26 Jun 2022 13:55:24 +0200 Salvatore Bonaccorso 
 wrote:

Source: salt



The following vulnerability was published for salt.

CVE-2022-22967[0]:
| An issue was discovered in SaltStack Salt in versions before 3002.9,
| 3003.5, 3004.2. PAM auth fails to reject locked accounts, which allows
| a previously authorized user whose account is locked still run Salt
| commands when their account is locked. This affects both local shell
| accounts with an active session and salt-api users that authenticate
| via PAM eauth.



As much as I'd like to stay away from fixing packages, do you need help 
with this one? It causing RC issues in testing even though it's removed.


https://qa.debian.org/dose/debcheck/src_testing_main/1661922002/packages/pytest-testinfra.html#076c12ad0c0676e354433b4fd854e3d5

There's a new upstream release and I pulled it locally, but there are a 
lot of changes. So without experience with the package, it's a bit much 
to go over.


Paul

PS: please CC me in reply.


OpenPGP_signature
Description: OpenPGP digital signature

Bug#1018842: telegram-destop: FTBFS with libabsl20220623

[Nicholas Guriev]

Control: tag -1 ftbfs

I haven't opportunity to check this yet. But it seems the libtgowt package 
needs to be rebuild as well. This package contains a static library and so 
brings the abseil dependency. For some reason, libtgowt is not in the 
transition plan, though there is libabsl-dev on the Depends list.


signature.asc
Description: This is a digitally signed message part.

Processed: Re: Bug#1018842: telegram-destop: FTBFS with libabsl20220623

[Debian Bug Tracking System]

Processing control commands:

> tag -1 ftbfs
Bug #1018842 [src:telegram-desktop] telegram-destop: FTBFS with libabsl20220623
Added tag(s) ftbfs.

-- 
1018842: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1018842
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#1005832: marked as done (broken libreoffice trigger and /usr/lib/libreoffice/share/extensions missing; libreoffice fails to start when last extension is removed (/usr/lib/libreoffice/share/extensi

[Debian Bug Tracking System]

Your message dated Thu, 01 Sep 2022 04:59:27 +
with message-id 
and subject line Bug#1018750: fixed in libreoffice 1:7.4.1~rc1-3
has caused the Debian Bug report #1018750,
regarding broken libreoffice trigger and /usr/lib/libreoffice/share/extensions 
missing; libreoffice fails to start when last extension is removed 
(/usr/lib/libreoffice/share/extensions being a 0-byte file)
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1018750: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1018750
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
package: libreoffice
version: 1:7.3.0-1

Hi Rene,

Long time (:

I've done some package cleaning and libreoffice stopped working.
with this failure:

$ libreoffice
terminate called after throwing an instance of
'com::sun::star::deployment::DeploymentException'
Unspecified Application Error

After some retracing I figured it happens due to the lack
of libreoffice-nlpsolver installed.

Notice this is also important due to the
dependency on libreoffice-java-common (all the other libreoffice only
recommend it).

Without the java packages libreoffice fails with

$ libreoffice


Fatal exception: Signal 11
Stack:
/usr/lib/libreoffice/program/libuno_sal.so.3(+0x37b43)[0x7fd0f70ccb43]
/usr/lib/libreoffice/program/libuno_sal.so.3(+0x37d24)[0x7fd0f70ccd24]
/lib/x86_64-linux-gnu/libc.so.6(+0x3c910)[0x7fd0f6ef5910]
/usr/lib/libreoffice/program/libuno_cppu.so.3(+0x17eb5)[0x7fd0f512ceb5]
/usr/lib/libreoffice/program/libuno_cppu.so.3(+0x16444)[0x7fd0f512b444]
/usr/lib/libreoffice/program/libmergedlo.so(+0x28144fc)[0x7fd0f990e4fc]
/usr/lib/libreoffice/program/libmergedlo.so(+0x281a9f5)[0x7fd0f99149f5]
/usr/lib/libreoffice/program/libmergedlo.so(_ZN3utl10ConfigItemC2ERKN3rtl8OUStringE14ConfigItemMode+0x7e)[0x7fd0f9914bae]
/usr/lib/libreoffice/program/libmergedlo.so(_ZN19SvtSysLocaleOptionsC1Ev+0x18d)[0x7fd0f994339d]
/usr/lib/libreoffice/program/libmergedlo.so(_Z7InitVCLv+0x246)[0x7fd0f9d29fe6]
/usr/lib/libreoffice/program/libmergedlo.so(_Z10ImplSVMainv+0x335)[0x7fd0f9d2a955]
/usr/lib/libreoffice/program/libmergedlo.so(soffice_main+0x181)[0x7fd0f8ec30a1]
/usr/lib/libreoffice/program/soffice.bin(+0x108c)[0x564b39f7408c]
/lib/x86_64-linux-gnu/libc.so.6(__libc_start_main+0xcd)[0x7fd0f6ee07ed]
/usr/lib/libreoffice/program/soffice.bin(+0x10ca)[0x564b39f740ca]

which is the case if libreoffice is installed without the recommended
packages.

to reproduce:

# apt-get install libreoffice --no-install-recommends
Reading package lists... Done
Building dependency tree... Done
Reading state information... Done
The following additional packages will be installed:
  coinor-libcbc3 coinor-libcgl1 coinor-libclp1 coinor-libcoinmp1v5
coinor-libcoinutils3v5 coinor-libosi1v5 fonts-opensymbol libabsl20210324
libabw-0.1-1 libboost-iostreams1.74.0 libbox2d2
  libcdr-0.1-1 libclucene-contribs1v5 libclucene-core1v5 libe-book-0.1-1
libeot0 libepubgen-0.1-1 libetonyek-0.1-1 libexttextcat-2.0-0
libexttextcat-data libfreehand-0.1-1 libgpgme11
  libgpgmepp6 liblangtag-common liblangtag1 libmhash2 libmspub-0.1-1
libmwaw-0.3-3 libmythes-1.2-0 libnumbertext-1.0-0 libnumbertext-data
libodfgen-0.1-1 liborcus-0.17-0
  liborcus-parser-0.17-0 libpagemaker-0.0-0 libqxp-0.0-0 libraptor2-0
librasqal3 librdf0 libreoffice-base libreoffice-base-core
libreoffice-base-drivers libreoffice-calc libreoffice-common
  libreoffice-core libreoffice-draw libreoffice-impress libreoffice-math
libreoffice-report-builder-bin libreoffice-style-colibre libreoffice-writer
librevenge-0.0-0 libstaroffice-0.0-0
  libuno-cppu3 libuno-cppuhelpergcc3-3 libuno-purpenvhelpergcc3-3
libuno-sal3 libuno-salhelpergcc3-3 libvisio-0.1-1 libwpd-0.10-10
libwpg-0.3-3 libwps-0.4-4 libxmlsec1-nss libyajl2
  libzmf-0.0-0 libzxingcore1 lp-solve python3-uno uno-libs-private ure

to fix after that:
# apt-get install libreoffice-nlpsolver

Thanks,

Kaplan

+972-52-2235911
L: Lior Kaplan 
T: @opensource_il 
F: @liorkaplanopensource 
https://kaplanopensource.co.il/
--- End Message ---
--- Begin Message ---
Source: libreoffice
Source-Version: 1:7.4.1~rc1-3
Done: Rene Engelhard 

We believe that the bug you reported is fixed in the latest version of
libreoffice, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 1018...@bugs.debian.org,
and 

Bug#1018750: marked as done (broken libreoffice trigger and /usr/lib/libreoffice/share/extensions missing; libreoffice fails to start when last extension is removed (/usr/lib/libreoffice/share/extensi

[Debian Bug Tracking System]

Your message dated Thu, 01 Sep 2022 04:59:27 +
with message-id 
and subject line Bug#1018750: fixed in libreoffice 1:7.4.1~rc1-3
has caused the Debian Bug report #1018750,
regarding broken libreoffice trigger and /usr/lib/libreoffice/share/extensions 
missing; libreoffice fails to start when last extension is removed 
(/usr/lib/libreoffice/share/extensions being a 0-byte file)
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1018750: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1018750
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---

Package: libreoffice-nlpsolver
Version: 7.4.1

SOFTWARE/OS VERSIONS
Operating System: Debian sid
KDE Plasma Version: 5.25.4
KDE Frameworks Version: 5.96.0
Qt Version: 5.15.4

If the libreoffice-nlpsolver package is not installed, libreoffice will 
crash at start (see below). This package should be set as dependency.



[New LWP 689176]
[New LWP 689177]
[New LWP 689178]
[Thread debugging using libthread_db enabled]
Using host libthread_db library "/lib/x86_64-linux-gnu/libthread_db.so.1".
0x7f6e472fda3f in __GI___poll (fds=0x7ffc488cce78, nfds=1, 
timeout=1000) at ../sysdeps/unix/sysv/linux/poll.c:29

[Current thread is 1 (Thread 0x7f6e40cb9180 (LWP 689175))]

Thread 4 (Thread 0x7f6e377fe640 (LWP 689178) "PipeIPC"):
#0  0x7f6e472d0d55 in __GI___clock_nanosleep 
(clock_id=clock_id@entry=0, flags=flags@entry=0, req=0x7f6e377fc2f0, 
rem=0x0) at ../sysdeps/unix/sysv/linux/clock_nanosleep.c:48
#1  0x7f6e472d57d3 in __GI___nanosleep (req=, 
rem=) at ../sysdeps/unix/sysv/linux/nanosleep.c:25
#2  0x7f6e4b950df6 in osl_waitThread () from 
/usr/lib/libreoffice/program/libuno_sal.so.3
#3  0x7f6e493f484a in ?? () from 
/usr/lib/libreoffice/program/libmergedlo.so
#4  0x7f6e45e0d6db in salhelper::Thread::run() () from 
/usr/lib/libreoffice/program/libuno_salhelpergcc3.so.3
#5  0x7f6e45e0d53a in ?? () from 
/usr/lib/libreoffice/program/libuno_salhelpergcc3.so.3
#6  0x7f6e4b94ec4b in ?? () from 
/usr/lib/libreoffice/program/libuno_sal.so.3
#7  0x7f6e47287b27 in start_thread (arg=) at 
./nptl/pthread_create.c:435
#8  0x7f6e4730a78c in clone3 () at 
../sysdeps/unix/sysv/linux/x86_64/clone3.S:81


Thread 3 (Thread 0x7f6e37fff640 (LWP 689177) "QDBusConnection"):
#0  __GI___libc_read (nbytes=16, buf=0x7f6e37ffd130, fd=8) at 
../sysdeps/unix/sysv/linux/read.c:26
#1  __GI___libc_read (fd=8, buf=0x7f6e37ffd130, nbytes=16) at 
../sysdeps/unix/sysv/linux/read.c:24

#2  0x7f6e4682f97f in ?? () from /lib/x86_64-linux-gnu/libglib-2.0.so.0
#3  0x7f6e467e18e5 in g_main_context_check () from 
/lib/x86_64-linux-gnu/libglib-2.0.so.0

#4  0x7f6e467e1d70 in ?? () from /lib/x86_64-linux-gnu/libglib-2.0.so.0
#5  0x7f6e467e1eec in g_main_context_iteration () from 
/lib/x86_64-linux-gnu/libglib-2.0.so.0
#6  0x7f6e403091de in 
QEventDispatcherGlib::processEvents(QFlags) 
() from /lib/x86_64-linux-gnu/libQt5Core.so.5
#7  0x7f6e402b009b in 
QEventLoop::exec(QFlags) () from 
/lib/x86_64-linux-gnu/libQt5Core.so.5
#8  0x7f6e400cab17 in QThread::exec() () from 
/lib/x86_64-linux-gnu/libQt5Core.so.5

#9  0x7f6e3e4e4487 in ?? () from /lib/x86_64-linux-gnu/libQt5DBus.so.5
#10 0x7f6e400cbcd1 in ?? () from /lib/x86_64-linux-gnu/libQt5Core.so.5
#11 0x7f6e47287b27 in start_thread (arg=) at 
./nptl/pthread_create.c:435
#12 0x7f6e4730a78c in clone3 () at 
../sysdeps/unix/sysv/linux/x86_64/clone3.S:81


Thread 2 (Thread 0x7f6e3d7ff640 (LWP 689176) "QXcbEventQueue"):
#0  0x7f6e472fda3f in __GI___poll (fds=0x7f6e3d7fd288, nfds=1, 
timeout=-1) at ../sysdeps/unix/sysv/linux/poll.c:29

#1  0x7f6e41c8cd12 in ?? () from /lib/x86_64-linux-gnu/libxcb.so.1
#2  0x7f6e41c8f07a in xcb_wait_for_event () from 
/lib/x86_64-linux-gnu/libxcb.so.1

#3  0x7f6e3dbc8e80 in ?? () from /lib/x86_64-linux-gnu/libQt5XcbQpa.so.5
#4  0x7f6e400cbcd1 in ?? () from /lib/x86_64-linux-gnu/libQt5Core.so.5
#5  0x7f6e47287b27 in start_thread (arg=) at 
./nptl/pthread_create.c:435
#6  0x7f6e4730a78c in clone3 () at 
../sysdeps/unix/sysv/linux/x86_64/clone3.S:81


Thread 1 (Thread 0x7f6e40cb9180 (LWP 689175) "soffice.bin"):
#0  0x7f6e472fda3f in __GI___poll (fds=0x7ffc488cce78, nfds=1, 
timeout=1000) at ../sysdeps/unix/sysv/linux/poll.c:29

#1  0x7f6e3e330180 in ?? () from /lib/x86_64-linux-gnu/libKF5Crash.so.5
#2  0x7f6e3e330b87 in KCrash::defaultCrashHandler(int) () from 
/lib/x86_64-linux-gnu/libKF5Crash.so.5
#3  0x7f6e4b94e8d4 in ?? () from 
/usr/lib/libreoffice/program/libuno_sal.so.3

#4  
#5  0x7f6e452796a5

Bug#1018750: marked as done (broken libreoffice trigger and /usr/lib/libreoffice/share/extensions missing; libreoffice fails to start when last extension is removed (/usr/lib/libreoffice/share/extensi

[Debian Bug Tracking System]

Your message dated Thu, 01 Sep 2022 04:59:27 +
with message-id 
and subject line Bug#1005832: fixed in libreoffice 1:7.4.1~rc1-3
has caused the Debian Bug report #1005832,
regarding broken libreoffice trigger and /usr/lib/libreoffice/share/extensions 
missing; libreoffice fails to start when last extension is removed 
(/usr/lib/libreoffice/share/extensions being a 0-byte file)
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1005832: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1005832
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---

Package: libreoffice-nlpsolver
Version: 7.4.1

SOFTWARE/OS VERSIONS
Operating System: Debian sid
KDE Plasma Version: 5.25.4
KDE Frameworks Version: 5.96.0
Qt Version: 5.15.4

If the libreoffice-nlpsolver package is not installed, libreoffice will 
crash at start (see below). This package should be set as dependency.



[New LWP 689176]
[New LWP 689177]
[New LWP 689178]
[Thread debugging using libthread_db enabled]
Using host libthread_db library "/lib/x86_64-linux-gnu/libthread_db.so.1".
0x7f6e472fda3f in __GI___poll (fds=0x7ffc488cce78, nfds=1, 
timeout=1000) at ../sysdeps/unix/sysv/linux/poll.c:29

[Current thread is 1 (Thread 0x7f6e40cb9180 (LWP 689175))]

Thread 4 (Thread 0x7f6e377fe640 (LWP 689178) "PipeIPC"):
#0  0x7f6e472d0d55 in __GI___clock_nanosleep 
(clock_id=clock_id@entry=0, flags=flags@entry=0, req=0x7f6e377fc2f0, 
rem=0x0) at ../sysdeps/unix/sysv/linux/clock_nanosleep.c:48
#1  0x7f6e472d57d3 in __GI___nanosleep (req=, 
rem=) at ../sysdeps/unix/sysv/linux/nanosleep.c:25
#2  0x7f6e4b950df6 in osl_waitThread () from 
/usr/lib/libreoffice/program/libuno_sal.so.3
#3  0x7f6e493f484a in ?? () from 
/usr/lib/libreoffice/program/libmergedlo.so
#4  0x7f6e45e0d6db in salhelper::Thread::run() () from 
/usr/lib/libreoffice/program/libuno_salhelpergcc3.so.3
#5  0x7f6e45e0d53a in ?? () from 
/usr/lib/libreoffice/program/libuno_salhelpergcc3.so.3
#6  0x7f6e4b94ec4b in ?? () from 
/usr/lib/libreoffice/program/libuno_sal.so.3
#7  0x7f6e47287b27 in start_thread (arg=) at 
./nptl/pthread_create.c:435
#8  0x7f6e4730a78c in clone3 () at 
../sysdeps/unix/sysv/linux/x86_64/clone3.S:81


Thread 3 (Thread 0x7f6e37fff640 (LWP 689177) "QDBusConnection"):
#0  __GI___libc_read (nbytes=16, buf=0x7f6e37ffd130, fd=8) at 
../sysdeps/unix/sysv/linux/read.c:26
#1  __GI___libc_read (fd=8, buf=0x7f6e37ffd130, nbytes=16) at 
../sysdeps/unix/sysv/linux/read.c:24

#2  0x7f6e4682f97f in ?? () from /lib/x86_64-linux-gnu/libglib-2.0.so.0
#3  0x7f6e467e18e5 in g_main_context_check () from 
/lib/x86_64-linux-gnu/libglib-2.0.so.0

#4  0x7f6e467e1d70 in ?? () from /lib/x86_64-linux-gnu/libglib-2.0.so.0
#5  0x7f6e467e1eec in g_main_context_iteration () from 
/lib/x86_64-linux-gnu/libglib-2.0.so.0
#6  0x7f6e403091de in 
QEventDispatcherGlib::processEvents(QFlags) 
() from /lib/x86_64-linux-gnu/libQt5Core.so.5
#7  0x7f6e402b009b in 
QEventLoop::exec(QFlags) () from 
/lib/x86_64-linux-gnu/libQt5Core.so.5
#8  0x7f6e400cab17 in QThread::exec() () from 
/lib/x86_64-linux-gnu/libQt5Core.so.5

#9  0x7f6e3e4e4487 in ?? () from /lib/x86_64-linux-gnu/libQt5DBus.so.5
#10 0x7f6e400cbcd1 in ?? () from /lib/x86_64-linux-gnu/libQt5Core.so.5
#11 0x7f6e47287b27 in start_thread (arg=) at 
./nptl/pthread_create.c:435
#12 0x7f6e4730a78c in clone3 () at 
../sysdeps/unix/sysv/linux/x86_64/clone3.S:81


Thread 2 (Thread 0x7f6e3d7ff640 (LWP 689176) "QXcbEventQueue"):
#0  0x7f6e472fda3f in __GI___poll (fds=0x7f6e3d7fd288, nfds=1, 
timeout=-1) at ../sysdeps/unix/sysv/linux/poll.c:29

#1  0x7f6e41c8cd12 in ?? () from /lib/x86_64-linux-gnu/libxcb.so.1
#2  0x7f6e41c8f07a in xcb_wait_for_event () from 
/lib/x86_64-linux-gnu/libxcb.so.1

#3  0x7f6e3dbc8e80 in ?? () from /lib/x86_64-linux-gnu/libQt5XcbQpa.so.5
#4  0x7f6e400cbcd1 in ?? () from /lib/x86_64-linux-gnu/libQt5Core.so.5
#5  0x7f6e47287b27 in start_thread (arg=) at 
./nptl/pthread_create.c:435
#6  0x7f6e4730a78c in clone3 () at 
../sysdeps/unix/sysv/linux/x86_64/clone3.S:81


Thread 1 (Thread 0x7f6e40cb9180 (LWP 689175) "soffice.bin"):
#0  0x7f6e472fda3f in __GI___poll (fds=0x7ffc488cce78, nfds=1, 
timeout=1000) at ../sysdeps/unix/sysv/linux/poll.c:29

#1  0x7f6e3e330180 in ?? () from /lib/x86_64-linux-gnu/libKF5Crash.so.5
#2  0x7f6e3e330b87 in KCrash::defaultCrashHandler(int) () from 
/lib/x86_64-linux-gnu/libKF5Crash.so.5
#3  0x7f6e4b94e8d4 in ?? () from 
/usr/lib/libreoffice/program/libuno_sal.so.3

#4  
#5  0x7f6e452796a5

Bug#1005832: marked as done (broken libreoffice trigger and /usr/lib/libreoffice/share/extensions missing; libreoffice fails to start when last extension is removed (/usr/lib/libreoffice/share/extensi

[Debian Bug Tracking System]

Your message dated Thu, 01 Sep 2022 04:59:27 +
with message-id 
and subject line Bug#1005832: fixed in libreoffice 1:7.4.1~rc1-3
has caused the Debian Bug report #1005832,
regarding broken libreoffice trigger and /usr/lib/libreoffice/share/extensions 
missing; libreoffice fails to start when last extension is removed 
(/usr/lib/libreoffice/share/extensions being a 0-byte file)
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1005832: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1005832
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
package: libreoffice
version: 1:7.3.0-1

Hi Rene,

Long time (:

I've done some package cleaning and libreoffice stopped working.
with this failure:

$ libreoffice
terminate called after throwing an instance of
'com::sun::star::deployment::DeploymentException'
Unspecified Application Error

After some retracing I figured it happens due to the lack
of libreoffice-nlpsolver installed.

Notice this is also important due to the
dependency on libreoffice-java-common (all the other libreoffice only
recommend it).

Without the java packages libreoffice fails with

$ libreoffice


Fatal exception: Signal 11
Stack:
/usr/lib/libreoffice/program/libuno_sal.so.3(+0x37b43)[0x7fd0f70ccb43]
/usr/lib/libreoffice/program/libuno_sal.so.3(+0x37d24)[0x7fd0f70ccd24]
/lib/x86_64-linux-gnu/libc.so.6(+0x3c910)[0x7fd0f6ef5910]
/usr/lib/libreoffice/program/libuno_cppu.so.3(+0x17eb5)[0x7fd0f512ceb5]
/usr/lib/libreoffice/program/libuno_cppu.so.3(+0x16444)[0x7fd0f512b444]
/usr/lib/libreoffice/program/libmergedlo.so(+0x28144fc)[0x7fd0f990e4fc]
/usr/lib/libreoffice/program/libmergedlo.so(+0x281a9f5)[0x7fd0f99149f5]
/usr/lib/libreoffice/program/libmergedlo.so(_ZN3utl10ConfigItemC2ERKN3rtl8OUStringE14ConfigItemMode+0x7e)[0x7fd0f9914bae]
/usr/lib/libreoffice/program/libmergedlo.so(_ZN19SvtSysLocaleOptionsC1Ev+0x18d)[0x7fd0f994339d]
/usr/lib/libreoffice/program/libmergedlo.so(_Z7InitVCLv+0x246)[0x7fd0f9d29fe6]
/usr/lib/libreoffice/program/libmergedlo.so(_Z10ImplSVMainv+0x335)[0x7fd0f9d2a955]
/usr/lib/libreoffice/program/libmergedlo.so(soffice_main+0x181)[0x7fd0f8ec30a1]
/usr/lib/libreoffice/program/soffice.bin(+0x108c)[0x564b39f7408c]
/lib/x86_64-linux-gnu/libc.so.6(__libc_start_main+0xcd)[0x7fd0f6ee07ed]
/usr/lib/libreoffice/program/soffice.bin(+0x10ca)[0x564b39f740ca]

which is the case if libreoffice is installed without the recommended
packages.

to reproduce:

# apt-get install libreoffice --no-install-recommends
Reading package lists... Done
Building dependency tree... Done
Reading state information... Done
The following additional packages will be installed:
  coinor-libcbc3 coinor-libcgl1 coinor-libclp1 coinor-libcoinmp1v5
coinor-libcoinutils3v5 coinor-libosi1v5 fonts-opensymbol libabsl20210324
libabw-0.1-1 libboost-iostreams1.74.0 libbox2d2
  libcdr-0.1-1 libclucene-contribs1v5 libclucene-core1v5 libe-book-0.1-1
libeot0 libepubgen-0.1-1 libetonyek-0.1-1 libexttextcat-2.0-0
libexttextcat-data libfreehand-0.1-1 libgpgme11
  libgpgmepp6 liblangtag-common liblangtag1 libmhash2 libmspub-0.1-1
libmwaw-0.3-3 libmythes-1.2-0 libnumbertext-1.0-0 libnumbertext-data
libodfgen-0.1-1 liborcus-0.17-0
  liborcus-parser-0.17-0 libpagemaker-0.0-0 libqxp-0.0-0 libraptor2-0
librasqal3 librdf0 libreoffice-base libreoffice-base-core
libreoffice-base-drivers libreoffice-calc libreoffice-common
  libreoffice-core libreoffice-draw libreoffice-impress libreoffice-math
libreoffice-report-builder-bin libreoffice-style-colibre libreoffice-writer
librevenge-0.0-0 libstaroffice-0.0-0
  libuno-cppu3 libuno-cppuhelpergcc3-3 libuno-purpenvhelpergcc3-3
libuno-sal3 libuno-salhelpergcc3-3 libvisio-0.1-1 libwpd-0.10-10
libwpg-0.3-3 libwps-0.4-4 libxmlsec1-nss libyajl2
  libzmf-0.0-0 libzxingcore1 lp-solve python3-uno uno-libs-private ure

to fix after that:
# apt-get install libreoffice-nlpsolver

Thanks,

Kaplan

+972-52-2235911
L: Lior Kaplan 
T: @opensource_il 
F: @liorkaplanopensource 
https://kaplanopensource.co.il/
--- End Message ---
--- Begin Message ---
Source: libreoffice
Source-Version: 1:7.4.1~rc1-3
Done: Rene Engelhard 

We believe that the bug you reported is fixed in the latest version of
libreoffice, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 1005...@bugs.debian.org,
and 

Bug#1015733: ghc: ABI reproducibility broken in 9.0.2

[Paul Gevers]

Hi all,

On Tue, 19 Jul 2022 17:51:07 -0400 Scott Talbert  wrote:

Haskell ABI reproducibility is broken in ghc 9.0.2.  If you rebuild the
ghc-9.0.2-3 package repeatedly, the library packages that it provides (e.g.,
libghc-array-dev, libghc-base-dev, etc.) will have different hashes.

Making this RC because it makes it impossible to rebuild the ghc package
without rebuilding all 1000+ Haskell packages at the same time.


Ping. Can this please be looked at? This is affecting more and more 
packages that can't migrate to testing (and I [Release Team hat on] 
don't want ghc in testing with this bug).


Paul


OpenPGP_signature
Description: OpenPGP digital signature

Processed: src:magic-haskell: fails to migrate to testing for too long: part of unfinshed ghc transition

[Debian Bug Tracking System]

Processing control commands:

> close -1 1.1-10
Bug #1018856 [src:magic-haskell] src:magic-haskell: fails to migrate to testing 
for too long: part of unfinshed ghc transition
Marked as fixed in versions magic-haskell/1.1-10.
Bug #1018856 [src:magic-haskell] src:magic-haskell: fails to migrate to testing 
for too long: part of unfinshed ghc transition
Marked Bug as done

-- 
1018856: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1018856
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#1018856: src:magic-haskell: fails to migrate to testing for too long: part of unfinshed ghc transition

[Paul Gevers]

Source: magic-haskell
Version: 1.1-9
Severity: serious
Control: close -1 1.1-10
Tags: sid bookworm
User: release.debian@packages.debian.org
Usertags: out-of-sync

Dear maintainer(s),

The Release Team considers packages that are out-of-sync between testing 
and unstable for more than 60 days as having a Release Critical bug in 
testing [1]. Your package src:magic-haskell has been trying to migrate 
for 61 days [2]. Hence, I am filing this bug. Your package is part of 
the unfinished ghc transition.


If a package is out of sync between unstable and testing for a longer 
period, this usually means that bugs in the package in testing cannot be 
fixed via unstable. Additionally, blocked packages can have impact on 
other packages, which makes preparing for the release more difficult. 
Finally, it often exposes issues with the package and/or
its (reverse-)dependencies. We expect maintainers to fix issues that 
hamper the migration of their package in a timely manner.


This bug will trigger auto-removal when appropriate. As with all new 
bugs, there will be at least 30 days before the package is auto-removed.


I have immediately closed this bug with the version in unstable, so if 
that version or a later version migrates, this bug will no longer affect 
testing. I have also tagged this bug to only affect sid and bookworm, so 
it doesn't affect (old-)stable.


If you believe your package is unable to migrate to testing due to 
issues beyond your control, don't hesitate to contact the Release Team.


Paul

[1] https://lists.debian.org/debian-devel-announce/2020/02/msg5.html
[2] https://qa.debian.org/excuses.php?package=magic-haskell


OpenPGP_signature
Description: OpenPGP digital signature

Bug#1018801: stdx-allocator ftbfs: assertThrown failed: No Exception was thrown.

[Matthias Klumpp]

Am Mi., 31. Aug. 2022 um 03:01 Uhr schrieb Steve Langasek
:
>
> Source: stdx-allocator
> Version: 3.1.0~beta.2-3
> Severity: serious
> User: ubuntu-de...@lists.ubuntu.com
> Usertags: origin-ubuntu kinetic
>
> Hi Matthias,
>
> After fixing up stdx-allocator build-deps so that they're installable,
> stdx-allocator fails to build from source due to a test failure:
>
> [...]

Hah! I need to test this, but this *may* just be related to removing
the dip1008 flag from the mir-core flags list entirely - it may be
needed after all.
Or this is completely unrelated to that and a completely different bug
- unfortunately, I can only really dive into this at the weekend...

Thanks!
Matthias

-- 
I welcome VSRE emails. See http://vsre.info/

Bug#1018796: mir-core: FTBFS with gdc: unrecognized commandline option -preview=dip1008

[Matthias Klumpp]

Am Mi., 31. Aug. 2022 um 01:09 Uhr schrieb Steve Langasek
:
>
> Package: mir-core
> Version: 1.1.111-1
> Severity: serious
> Tags: patch
> Justification: ftbfs
> User: ubuntu-de...@lists.ubuntu.com
> Usertags: origin-ubuntu kinetic ubuntu-patch
>
> Hi Matthias,
>
> The mir-core package is failing to build on all gdc archs in unstable
> because meson.build includes a compiler option, '-preview=dip1008', which is
> ldc-specific and not understood by gdc.
>
> Patching this option out lets the package build on all archs, including
> those using ldc, so it doesn't appear to be needed.

How odd, that particular DIP was apparently postponed:
https://github.com/dlang/DIPs/blob/master/DIPs/other/DIP1008.md
Not sure if we can just drop the flag, but I assume the answer is yes,
in which case we should forward this patch upstream as well.
If not, then the Meson code needs to pass "-fpreview=dip1008" (instead
of -preview...) to the compiler if its identifier is gnu.
Thanks for looking into this!

-- 
I welcome VSRE emails. See http://vsre.info/

Processed: unarchiving 993452, reopening 993452

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> unarchive 993452
Bug #993452 {Done: Stephen Kitt } [osslsigncode] 
osslsigncode: MSI tests fail on big-endian architectures
Unarchived Bug 993452
> reopen 993452
Bug #993452 {Done: Stephen Kitt } [osslsigncode] 
osslsigncode: MSI tests fail on big-endian architectures
'reopen' may be inappropriate when a bug has been closed with a version;
all fixed versions will be cleared, and you may need to re-add them.
Bug reopened
No longer marked as fixed in versions osslsigncode/2.3.0-1.
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
993452: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=993452
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Processed: retitle 1017579 to freeciv: CVE-2022-39047: Modpack Installer buffer overflow

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> retitle 1017579 freeciv: CVE-2022-39047: Modpack Installer buffer overflow
Bug #1017579 {Done: Tobias Frost } [src:freeciv] freeciv: 
CVE-2022-3904: Modpack Installer buffer overflow
Changed Bug title to 'freeciv: CVE-2022-39047: Modpack Installer buffer 
overflow' from 'freeciv: CVE-2022-3904: Modpack Installer buffer overflow'.
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
1017579: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1017579
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Processed: bug 993452 is forwarded to https://github.com/mtrojnar/osslsigncode/issues/182

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> forwarded 993452 https://github.com/mtrojnar/osslsigncode/issues/182
Bug #993452 [osslsigncode] osslsigncode: MSI tests fail on big-endian 
architectures
Set Bug forwarded-to-address to 
'https://github.com/mtrojnar/osslsigncode/issues/182'.
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
993452: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=993452
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#1009915: sysvinit: Please align with manpages-l10n and afterwards activate man page translations

[Thorsten Glaser]

On Wed, 31 Aug 2022, Mark Hindley wrote:

> > there seems to be one manpage (in bootlogd) missing conflict handling:
> > 
> > /usr/share/man/fr/man8/bootlogd.8.gz
> 
> Thanks. I was under the impression that manpages-i10n had changed to
> systemd versions (which doesn't have bootlogd.8) but apparently not. I
> think we should continue to use the manpages-i10n version and not have
> any more dpkg diversions than are absolutely necessary.
> 
> I am away for a week, but will resolve this once I am back.

Perhaps in this time a french speaker can compare the two versions,
from sysvinit and manpages-l10n, and see which one is “better”, then
contribute that to sysvinit so manpages-l10n can remove theirs as
bootlogd isn’t provided with systemd?

bye,
//mirabilos
-- 
Infrastrukturexperte • tarent solutions GmbH
Am Dickobskreuz 10, D-53121 Bonn • http://www.tarent.de/
Telephon +49 228 54881-393 • Fax: +49 228 54881-235
HRB AG Bonn 5168 • USt-ID (VAT): DE122264941
Geschäftsführer: Dr. Stefan Barth, Kai Ebenrett, Boris Esser, Alexander Steeg


/⁀\ The UTF-8 Ribbon
╲ ╱ Campaign against  Mit dem tarent-Newsletter nichts mehr verpassen:
 ╳  HTML eMail! Also, https://www.tarent.de/newsletter
╱ ╲ header encryption!

Bug#1010698: marked as done (stunnel4: runtime check on openssl too tight?)

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 20:59:17 +
with message-id 
and subject line Bug#1010698: fixed in stunnel4 3:5.63-1.1
has caused the Debian Bug report #1010698,
regarding stunnel4: runtime check on openssl too tight?
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1010698: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1010698
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: stunnel4
Version: 3:5.63-1
Severity: serious
User: debian...@lists.debian.org
Usertags: flaky

The debci testsuite failed for all architectures after the recent
openssl upload
   
https://ci.debian.net/data/autopkgtest/testing/amd64/s/stunnel4/21436404/log.gz

Am I right to assume as per
| logs/results.log:DEBUG: 2022-05-07 04:07:41,445: [get_version] Trying to 
obtain the version of 
/tmp/autopkgtest-lxc.algiqp59/downtmp/build.oOV/src/tests/../src/stunnel
| logs/results.log:DEBUG: 2022-05-07 04:07:41,446: [get_version] Started 
`/tmp/autopkgtest-lxc.algiqp59/downtmp/build.oOV/src/tests/../src/stunnel 
-version` as process 1544
| logs/results.log:CRITICAL: 2022-05-07 04:07:41,449: [main] Something went 
wrong: Stunnel was compiled and run with various OpenSSL versions
…
| autopkgtest [04:07:41]: test upstream: ---]
| upstream FAIL non-zero exit status 1
| autopkgtest [04:07:41]: test upstream:  - - - - - - - - - - results - - - - - 
- - - - -
| autopkgtest [04:07:41]:  summary
| debian-pythonPASS
| upstream FAIL non-zero exit status 1

that the error is that it was compiled against one version (1.1.1n)
and then tested against another version (1.1.1o)?
stunnel4 -version reports:
| Compiled with OpenSSL 1.1.1n  15 Mar 2022
| Running  with OpenSSL 1.1.1o  3 May 2022

and it is fine, the ABI is stable.

Sebastian
--- End Message ---
--- Begin Message ---
Source: stunnel4
Source-Version: 3:5.63-1.1
Done: Paul Gevers 

We believe that the bug you reported is fixed in the latest version of
stunnel4, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 1010...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Paul Gevers  (supplier of updated stunnel4 package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

Format: 1.8
Date: Wed, 31 Aug 2022 21:59:52 +0200
Source: stunnel4
Architecture: source
Version: 3:5.63-1.1
Distribution: unstable
Urgency: medium
Maintainer: Peter Pentchev 
Changed-By: Paul Gevers 
Closes: 1010698
Changes:
 stunnel4 (3:5.63-1.1) unstable; urgency=medium
 .
   * Non-maintainer upload
 .
   [ Simon Chopin ]
   * Fix autopkgtests on new OpenSSL versions (Closes: #1010698)
Checksums-Sha1:
 2a3156cc7db1468a04a78d3397257c228580b93a 2181 stunnel4_5.63-1.1.dsc
 829385578e6922c5ba93aa8f03316644065ef05b 51340 stunnel4_5.63-1.1.debian.tar.xz
Checksums-Sha256:
 c421714c8c8215e9a0a6771dc4c60de3ed30925cf32f57cb8fb63c11f5ee537c 2181 
stunnel4_5.63-1.1.dsc
 8272a3eb40069dce64dae67d0363518d3df4b85fddd6a48ac29d5111cb55ca21 51340 
stunnel4_5.63-1.1.debian.tar.xz
Files:
 f56507e27dec4bc24c15ecc0541b5777 2181 net optional stunnel4_5.63-1.1.dsc
 086e28a461724cc402913d76a40f19cd 51340 net optional 
stunnel4_5.63-1.1.debian.tar.xz

-BEGIN PGP SIGNATURE-

iQEzBAEBCAAdFiEEWLZtSHNr6TsFLeZynFyZ6wW9dQoFAmMPvnEACgkQnFyZ6wW9
dQpv2ggAxVQqOd7KCBYer4Nx5PVtTlGiButVa45KnoWVXOSXbguqCvABS2HMliq2
anTa4+1ufLOlQk8aqF1O0Br6+SM8P8CFv4Ab9TZIMkQJG1mzl92I5csMM5XHoUgc
DO0d+9pDV4jEfSfgn/Y87bM7JkpmLRhtPnqHb+kZqNgrlehZeAOOMkC57ylvvKIi
a91AbAXV12fKQh/6IBMSGP4cDpOdwA4Kt+7ZpJGr6idrRJP5M2+NUfCPP5NDJDi9
gt5BZeJYccjwBNmBtnQ68yzP5qkObqHhbPNUIIoIKTJNYosMkZqf1BwM1ScpAOXk
VuvNbNI2ytkQTroa436fWi/GHsE1NQ==
=q2JS
-END PGP SIGNATURE End Message ---

Bug#1017579: marked as done (freeciv: CVE-2022-3904: Modpack Installer buffer overflow)

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 19:20:01 +
with message-id 
and subject line Bug#1017579: fixed in freeciv 3.0.3-1
has caused the Debian Bug report #1017579,
regarding freeciv: CVE-2022-3904: Modpack Installer buffer overflow
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1017579: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1017579
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: freeciv
Version: 2.6.6-1
Severity: grave
Tags: security
X-Debbugs-Cc: Debian Security Team 

Quoting from the announcement posted to oss-security (no CVE is
available):

--
 Just released freeciv-2.6.7 & freeciv-3.0.3 fix buffer overflow in
 Modpack Installer utility's handling of the modpack URL. Specially
 crafted URLs, without any '/' -characters would result in an
 underflowing length (unsigned)(-1) string copy, i.e., all of the
 NULL-terminated string given as "URL" would get written beyond the
 buffer reserved for it.

 Freeciv source tarballs are available from
 https://www.freeciv.org/download.html for current 3.0, and from
 https://www.freeciv.org/wiki/Old_downloads for 2.6.

 In case you can't make full version update at the moment, bug tracker
 ticket has also a patch for this single issue attached:
 https://osdn.net/projects/freeciv/ticket/45299
--
--- End Message ---
--- Begin Message ---
Source: freeciv
Source-Version: 3.0.3-1
Done: Tobias Frost 

We believe that the bug you reported is fixed in the latest version of
freeciv, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 1017...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Tobias Frost  (supplier of updated freeciv package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

Format: 1.8
Date: Wed, 31 Aug 2022 20:39:45 +0200
Source: freeciv
Architecture: source
Version: 3.0.3-1
Distribution: unstable
Urgency: medium
Maintainer: Debian Games Team 
Changed-By: Tobias Frost 
Closes: 631775 984807 1013426 1013429 1017579
Changes:
 freeciv (3.0.3-1) unstable; urgency=medium
 .
   * New upstream release. (Closes: #631775, #1013429, #1017579)
   * Refreshing patches.
   * Fix cleaning of project to prepare for build two time… (Closes: #1013426)
 * remove lua in d/clean, not just prior to build
 * that allows one to drop some overrides from d/rules
 * Use upstreams configure flag enable-sys-lua=yes, but that still needs
   patching of configure.ac and a Makefile.am.
   * Break/Replaces on freeciv-data are no longer needed (version fulfilled
 since oldstable.)
   * Retire package freeciv-sound-standard and merge it into
 freeciv-data. (Closes: #984807)
   * Update d/copyright.
   * Bump S-V to 4.6.1, no changes needed.
   * Fix manpage section of ruledit.6 (manpage.patch).
   * Add symlink to freeciv-gtk3.6 manpage.
   * Change dh_missing policy to fail-missing.
   * Specify Rules-Requires-Root:no.
   * Simplify d/rules.
   * Add patch with spelling fixes.
   * Adding myself as uploaders.
   * Removing Karl Goetz from uploaders. Thanks for your past work!
Checksums-Sha1:
 d417b5e5357f08084a96fdc7d216964552f893ff 2728 freeciv_3.0.3-1.dsc
 c3af22d735a128a2855ee38d6bf969da6e0084c3 33538868 freeciv_3.0.3.orig.tar.xz
 72616773d48b134554dc122017b17d83c1458a07 28408 freeciv_3.0.3-1.debian.tar.xz
 3d34807858ba475a96fbdea09ed1da400886e952 21253 freeciv_3.0.3-1_amd64.buildinfo
Checksums-Sha256:
 4198553731cc30cb030493eda76cbe9dc126570fbfb971407deb9171adfa5d7b 2728 
freeciv_3.0.3-1.dsc
 13215adc96be9f2894d5f3a12c78b8ebb9ae06ecdab25fe6bb1794f6e6d2b61b 33538868 
freeciv_3.0.3.orig.tar.xz
 29245c8453836a921a2e59261175609491e18592cb5721a7ccbdb64d6eb2fb4a 28408 
freeciv_3.0.3-1.debian.tar.xz
 ff83131976ba7484926a09b8620c73819e5ab6bcf0771fbb98544d4db4d22129 21253 
freeciv_3.0.3-1_amd64.buildinfo
Files:
 3b6f0cd01087b8426792a2ea913e5ada 2728 games optional freeciv_3.0.3-1.dsc
 7f0347d6515bfa97c4bdec0a3419b05c 33538868 games optional 
freeciv_3.0.3.orig.tar.xz
 e6644c2a7c39c22a861c2a4ffe9dabf2 28408 games optional 
freeciv_3.0.3

Bug#1017946: marked as done (rust-pyo3-build-config: unsatisfiable dep on librust-python3-dll-a-0.2+default-dev)

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 20:03:06 +0100
with message-id 
and subject line librust-python3-dll-a uploaded
has caused the Debian Bug report #1017946,
regarding rust-pyo3-build-config: unsatisfiable dep on 
librust-python3-dll-a-0.2+default-dev
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1017946: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1017946
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: librust-pyo3-build-config+python3-dll-a-dev
Version: 0.16.4-2
Severity: grave
User: ubuntu-de...@lists.ubuntu.com
Usertags: origin-ubuntu kinetic

Hi Jelmer,

rust-pyo3-build-config currently builds a
librust-pyo3-build-config+python3-dll-a-dev binary package, which depends on
librust-python3-dll-a-0.2+default-dev.  But rust-python3-dll-a does not
appear to have been uploaded anywhere in Debian (it's not in unstable, or in
the NEW queue).  This makes rust-pyo3-build-config unreleasable, since
uninstallable binary packages will not migrate to testing.

Please either upload rust-python3-dll-a, or drop the uninstallable package.

-- 
Steve Langasek   Give me a lever long enough and a Free OS
Debian Developer   to set it on, and I can move the world.
Ubuntu Developer   https://www.debian.org/
slanga...@ubuntu.com vor...@debian.org


signature.asc
Description: PGP signature
--- End Message ---
--- Begin Message ---
Thanks for the bugreport.

I hadn't seen this bug report, but uploaded rust-python3-dll-a earlier.



signature.asc
Description: PGP signature
--- End Message ---

Bug#1018842: telegram-destop: FTBFS with libabsl20220623

[Sebastian Ramacher]

Source: telegram-desktop
Version: 4.1.1+ds-1
Severity: serious
X-Debbugs-Cc: sramac...@debian.org

https://buildd.debian.org/status/fetch.php?pkg=telegram-desktop&arch=amd64&ver=4.1.1%2Bds-1%2Bb1&stamp=1661970826&raw=0

(.text+0x912): undefined reference to 
`absl::debian2::optional_internal::throw_bad_optional_access()'
/usr/bin/ld: /usr/lib/x86_64-linux-gnu/libtg_owt.a(var_int.cc.o): in function 
`webrtc::DecodeVarInt(absl::debian2::string_view, unsigned long*)':
(.text+0x2b4): undefined reference to 
`absl::debian2::base_internal::ThrowStdOutOfRange(char const*)'
/usr/bin/ld: /usr/lib/x86_64-linux-gnu/libtg_owt.a(video_codec.cc.o): in 
function `webrtc::PayloadStringToCodecType(std::__cxx11::basic_string, std::allocator > const&)':
(.text+0x521): undefined reference to 
`absl::debian2::EqualsIgnoreCase(absl::debian2::string_view, 
absl::debian2::string_view)'
/usr/bin/ld: (.text+0x54a): undefined reference to 
`absl::debian2::EqualsIgnoreCase(absl::debian2::string_view, 
absl::debian2::string_view)'
/usr/bin/ld: (.text+0x573): undefined reference to 
`absl::debian2::EqualsIgnoreCase(absl::debian2::string_view, 
absl::debian2::string_view)'
/usr/bin/ld: (.text+0x59c): undefined reference to 
`absl::debian2::EqualsIgnoreCase(absl::debian2::string_view, 
absl::debian2::string_view)'
/usr/bin/ld: (.text+0x5c1): undefined reference to 
`absl::debian2::EqualsIgnoreCase(absl::debian2::string_view, 
absl::debian2::string_view)'
/usr/bin/ld: 
/usr/lib/x86_64-linux-gnu/libtg_owt.a(video_codec.cc.o):(.text+0x5e2): more 
undefined references to 
`absl::debian2::EqualsIgnoreCase(absl::debian2::string_view, 
absl::debian2::string_view)' follow
/usr/bin/ld: /usr/lib/x86_64-linux-gnu/libtg_owt.a(rtp_header_extensions.cc.o): 
in function 
`webrtc::AbsoluteCaptureTimeExtension::Write(rtc::ArrayView, webrtc::AbsoluteCaptureTime const&)':
(.text+0x1b7): undefined reference to 
`absl::debian2::optional_internal::throw_bad_optional_access()'
/usr/bin/ld: /usr/lib/x86_64-linux-gnu/libtg_owt.a(media_protocol_names.cc.o): 
in function `cricket::IsRtpProtocol(absl::debian2::string_view)':
(.text+0xf2): undefined reference to 
`absl::debian2::string_view::find(absl::debian2::string_view, unsigned long) 
const'
/usr/bin/ld: 
/usr/lib/x86_64-linux-gnu/libtg_owt.a(link_capacity_estimator.cc.o): in 
function `webrtc::LinkCapacityEstimator::deviation_estimate_kbps() const':
(.text+0x595): undefined reference to 
`absl::debian2::optional_internal::throw_bad_optional_access()'
/usr/bin/ld: warning: creating DT_TEXTREL in a PIE
collect2: error: ld returned 1 exit status
make[3]: *** [Telegram/CMakeFiles/Telegram.dir/build.make:10757: 
telegram-desktop] Error 1
make[3]: Leaving directory '/<>/obj-x86_64-linux-gnu'
make[2]: *** [CMakeFiles/Makefile2:1267: Telegram/CMakeFiles/Telegram.dir/all] 
Error 2
make[2]: Leaving directory '/<>/obj-x86_64-linux-gnu'
make[1]: *** [Makefile:139: all] Error 2
make[1]: Leaving directory '/<>/obj-x86_64-linux-gnu'
dh_auto_build: error: cd obj-x86_64-linux-gnu && make -j4 "INSTALL=install 
--strip-program=true" VERBOSE=1 returned exit code 2
make: *** [debian/rules:90: binary-arch] Error 25
dpkg-buildpackage: error: debian/rules binary-arch subprocess returned exit 
status 2

Build finished at 2022-08-31T18:33:35Z

Cheers
-- 
Sebastian Ramacher

Bug#1018766: marked as done (python3-progressbar2: file conflicts with python3-progressbar)

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 18:07:45 +
with message-id 
and subject line Bug#1018766: fixed in progressbar2 4.0.0-3
has caused the Debian Bug report #1018766,
regarding python3-progressbar2: file conflicts with python3-progressbar
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1018766: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1018766
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: python3-progressbar2
Version: 4.0.0-2
Severity: serious
User: debian...@lists.debian.org
Usertags: piuparts

Hi,

during a test with piuparts I noticed your package failed to install
because it tries to overwrite other packages files.

>From the attached log (scroll to the bottom...):

  Selecting previously unselected package python3-progressbar2.
  Preparing to unpack .../python3-progressbar2_4.0.0-2_all.deb ...
  Unpacking python3-progressbar2 (4.0.0-2) ...
  dpkg: error processing archive 
/var/cache/apt/archives/python3-progressbar2_4.0.0-2_all.deb (--unpack):
   trying to overwrite 
'/usr/lib/python3/dist-packages/progressbar/__init__.py', which is also in 
package python3-progressbar 2.5-3
  Errors were encountered while processing:
   /var/cache/apt/archives/python3-progressbar2_4.0.0-2_all.deb

The conflicting files are

usr/lib/python3/dist-packages/progressbar/__init__.py
usr/lib/python3/dist-packages/progressbar/widgets.py

I don't know how these two packages relate to each other, so I cannot
give good advice how to handle that conflict.


cheers,

Andreas


python3-progressbar=2.5-3_python3-progressbar2=4.0.0-2.log.gz
Description: application/gzip
--- End Message ---
--- Begin Message ---
Source: progressbar2
Source-Version: 4.0.0-3
Done: Edward Betts 

We believe that the bug you reported is fixed in the latest version of
progressbar2, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 1018...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Edward Betts  (supplier of updated progressbar2 package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Wed, 31 Aug 2022 18:39:50 +0100
Source: progressbar2
Architecture: source
Version: 4.0.0-3
Distribution: unstable
Urgency: medium
Maintainer: Debian Python Team 
Changed-By: Edward Betts 
Closes: 1018766
Changes:
 progressbar2 (4.0.0-3) unstable; urgency=medium
 .
   * Conflict with python3-progressbar. The name of the Python library
 within this package is also progressbar. (Closes: #1018766)
Checksums-Sha1:
 d42687a9a3ed5d54109b003dc367a393b947fc81 2253 progressbar2_4.0.0-3.dsc
 854c1f42c341e1a7e7b3353ca154537841e23b91 2684 
progressbar2_4.0.0-3.debian.tar.xz
 c124eec029f879810800dcdb5f820cfdf888680b 8459 
progressbar2_4.0.0-3_source.buildinfo
Checksums-Sha256:
 a29f60b3417bebd5e2e8e3867b39e3d6f7af1f58b34f2585edce612f64064e35 2253 
progressbar2_4.0.0-3.dsc
 9e9e51425784a266f0db6d0f581f087f655840ed87f7e5f0c9ee5aefadfdc0f9 2684 
progressbar2_4.0.0-3.debian.tar.xz
 e289c9d76565520dc3d28db09ac18abed3f8c7d5b858b2d2f584913e7fa64346 8459 
progressbar2_4.0.0-3_source.buildinfo
Files:
 5b780a00b2a2cb11b242919aacfc1b02 2253 python optional progressbar2_4.0.0-3.dsc
 28515c46510656b477d530280fe2aa03 2684 python optional 
progressbar2_4.0.0-3.debian.tar.xz
 1bdf08bb69215b6f00b6b181c9882463 8459 python optional 
progressbar2_4.0.0-3_source.buildinfo

-BEGIN PGP SIGNATURE-

iQIzBAEBCgAdFiEE+4rPp4xyYInDitAmlgWhCYxjuSoFAmMPndgACgkQlgWhCYxj
uSrxpg//ZcFSGLK0EoHR0aV/XUFwE7MvDlUTub605jCmvL7Z3BRKu2Y1CzBoB787
z1MlyI/bRj5iJtRo7CvgwMptLsoMtwxoyt29AM17h6XXJz74pbYHojcsuRJXJ5e4
J5UeD6a+pN68polXJhJMnUAcCiC0eus1mYwh3tTD/fj8PGIcNlBHm5Rs1C8WTKmc
CjSzi0bGX3IBVSBj1umrg6KijwoLmNpvvU4zW/1CWTEyjidB3KuBxwCOHn4TwwvL
f/0SBJ0pAqd0JRL18DpUNQb9QdPG0BOtVziCxQX+zZKdoIWL/gHkd/AUXqFKQQVs
hYWhh5vj4octjfx0fSKjuu6Mps7XaC/rhvtOYj3EzlsNOZFYcYuxH5Wf3zRDer3b
g5PdLTTkADpr+M03Ce+f7SrnAUr0EWlFIYSj1jBUn/1Rf1ixB5YqHoFz1+e9Uwfa
zn/klbEu2IwwrhW/+tN1oWrQxOkMuWQc7xXiTa4HWq28wFJfr+Fh539ouDVXr80r
l1N11Uh5GjL5wir1VM/Cdlu4B7tXfI9GyKsAJGHCWELVK7UOaoPBwql9HpQQTjHo
CJKHbHldHhajZWAsnyy20cWYqyGlNsyVqAYvSjIRVB90cm+3mBCpH6ew1Xro9fTn
VWU8dlwnC7vAz+3taUu4JNwC48lVd2vae3pfiFnHvh4hCXYau08=
=80Ri
-END PGP

Bug#1011951: marked as done (python-gevent: Build-Depends: libpython3.9-testsuite)

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 18:08:00 +
with message-id 
and subject line Bug#1011951: fixed in python-gevent 21.12.0-1
has caused the Debian Bug report #1011951,
regarding python-gevent: Build-Depends: libpython3.9-testsuite
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1011951: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1011951
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: python-gevent
Version: 21.8.0-1
Severity: important
Tags: ftbfs
User: debian-pyt...@lists.debian.org
Usertags: python3.10

Hi Maintainer

python-gevent has a hardcoded build-dependency on
libpython3.9-testsuite and will
FTBFS once Python 3.9 is removed from the archive.

I'm marking this bug important for now, and will raise severity once
the Python 3.9 removal transition is in progress.

Regards
Graham
--- End Message ---
--- Begin Message ---
Source: python-gevent
Source-Version: 21.12.0-1
Done: Emanuele Rocca 

We believe that the bug you reported is fixed in the latest version of
python-gevent, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 1011...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Emanuele Rocca  (supplier of updated python-gevent package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

Format: 1.8
Date: Wed, 31 Aug 2022 11:08:16 +0200
Source: python-gevent
Architecture: source
Version: 21.12.0-1
Distribution: unstable
Urgency: medium
Maintainer: Debian Python Team 
Changed-By: Emanuele Rocca 
Closes: 1011951
Changes:
 python-gevent (21.12.0-1) unstable; urgency=medium
 .
   * Team upload
   * New upstream release
   * Drop build-dependency on libpython3.9-testsuite (Closes: #1011951)
   * Add d/patches/fix-error-running_tests-docs.patch to fix an error when
 building running_tests.html. The command fails and results in a error
 being included in the HTML. Additionally, fixing this makes the build
 reproducible.
   * Set Standards-Version to 4.6.1 (no changes)
Checksums-Sha1:
 8aab6185b8f7ccaede9b5e5bdcb8ff1c0726b41c 2474 python-gevent_21.12.0-1.dsc
 8d8e1acb0d9748ec4fe40addc0fa065ccaecc677 4451447 
python-gevent_21.12.0.orig.tar.gz
 3f8324fdda5e06c628d45f7621d2bbbcf1529f99 72800 
python-gevent_21.12.0-1.debian.tar.xz
 f5ff3db748613c17516b194d41a12aa7936ed2d6 9914 
python-gevent_21.12.0-1_amd64.buildinfo
Checksums-Sha256:
 64772024c8ff17a27586b27f88bac75641711a282338ebf537818465c9aea1fc 2474 
python-gevent_21.12.0-1.dsc
 756ebc51a9e24b4ad58957e571d6a791b363cff0f0b9f19f7b2f1e573e044f58 4451447 
python-gevent_21.12.0.orig.tar.gz
 3815efd2eb300d19418789268c2d2ad5bb8c837e79fe59a8d3b6ecef99802ea7 72800 
python-gevent_21.12.0-1.debian.tar.xz
 f7d99679d9473dccbe9d3b9c4c8d7f25c42779da6f6c9a72e700161a86dde150 9914 
python-gevent_21.12.0-1_amd64.buildinfo
Files:
 57af0cb67b098403eb4adabca5d3ee87 2474 python optional 
python-gevent_21.12.0-1.dsc
 44fd12f4b48f1a84e48c3e000742f536 4451447 python optional 
python-gevent_21.12.0.orig.tar.gz
 a8639db70f8b47e14634151fea67a91f 72800 python optional 
python-gevent_21.12.0-1.debian.tar.xz
 5131d17380854d02cb92b01559f62d1b 9914 python optional 
python-gevent_21.12.0-1_amd64.buildinfo

-BEGIN PGP SIGNATURE-

iQIzBAEBCAAdFiEElUWWlhkoHBf/rFiR1QhaB1D9t6MFAmMPQsgACgkQ1QhaB1D9
t6MhBxAAi1P+G9y6doJznnrZOH+g8jR5JXv88D7CUPZtXwveA4GWZpmTB0CX8QuU
JfsFPnZS/Lt10Wuqh+ekMTrclBl0APC7zoO3v0KeV3n3iYeo+RV5/efnvtEs01/j
Zg52lTH59KhV+19h7gO/pNkMODi6rV8B5qL0in0SItj9lU56cQng8dVWcUTYGAuU
93H0mOhP2P/B/alMbNYKXO1GahSMqCrJlLQ1LoNpLBSrw77w28dZihqhRIL6mc30
P13I3deVrq4YmAnVNb63aNF9m2CwgQWO4KjPi/sIjDHaeyJ7TlW094Bo7PT+RZ+A
TWCUBX/wldMMMto2rG4yvym0NrqtS0ltAWH2uOCWeRuWbV4RMqGymth8N5WgM4EM
PDXvY6Jueq4wTqD31ytW3bK9rctHsyT4VzeJbim4CMi5juz4XjIzcY4gSinCGquI
FDcq1JCUoeU8k11zE2JEiLtTY/JxSUoQzTCnWWcjWJWMq/TO7bhgJ8k7l4G9qZhH
N9o1Zphod/3IvFlGwAiy6UrbJX0y7pfISzpW5WuMbsm9U8rDuARNkzgOim77hzfu
flxKc7tS5EySAptgPF7Rn4QXYmwrY2PL+qho0/ucIsRpnXPD83A9TahX4ff9iYdR
7qODImxhobFB232LE7/SyFgUxSTQ4vRE3n7kOWaIvgDdxXGtOd4=
=92oQ
-END PGP SIGNATURE End Message ---

Bug#1006033: marked as done (python-xlib: FTBFS: dh_auto_test: error: pybuild --test -i python{version} -p "3.10 3.9" returned exit code 13)

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 18:00:19 +
with message-id 
and subject line Bug#1006033: fixed in python-xlib 0.31-1
has caused the Debian Bug report #1006033,
regarding python-xlib: FTBFS: dh_auto_test: error: pybuild --test -i 
python{version} -p "3.10 3.9" returned exit code 13
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1006033: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1006033
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: python-xlib
Version: 0.29-1
Severity: serious
Justification: FTBFS
Tags: bookworm sid ftbfs

Hi,

During a rebuild of all packages in sid, your package failed to build
on amd64.


Relevant part (hopefully):
> make[1]: Entering directory '/<>'
> xvfb-run dh_auto_test
> I: pybuild base:237: cd /<>/.pybuild/cpython3_3.10_xlib/build; 
> python3.10 -m unittest discover -v 
> test (test.test_bytesview.BytesViewTest) ... ok
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> skipped 'big-endian tests, skipping on this system'
> testPack0 (test.test_events_le.TestClientMessage) ... ok
> testPack1 (test.test_events_le.TestClientMessage) ... ok
> testPack2 (test.test_events_le.TestClientMessage) ... ok
> testUnpack0 (test.test_events_le.TestClientMessage) ... ok
> testUnpack1 (test.test_events_le.TestClientMessage) ... ok
> testUnpack2 (test.test_events_le.TestClientMessage) ... ok
> testPack0 (test.test_events_le.TestColormapNotify) ... ok
> testUnpack0 (test.test_events_le.TestColormapNotify) ... ok
> testPack0 (test.test_events_le.TestConfigureNotify) ... ok
> testUnpack0 (test.test_events_le.TestConfigureNotify) ... ok
> testPack0 (test.test_events_le.TestConfigureRequest) ... ok
> testUnpack0 (test.test_events_le.TestConfigureRequest) ... ok
> testPack0 (test.test_events_le.TestCreateNotify) ... ok
> testUnpack0 (test.test_events_le.TestCreateNotify) ... ok
> testPack0 (test.test_events_le.TestDestroyNotify) ... ok
> testUnpack0 (test.test_events_le.TestDestroyNotify) ... ok
> testPack0 (test.test_events_le.TestExpose) ... ok
> testUnpack0 (test.test_events_le.TestExpose) ... ok
> testPack0 (test.test_events_le.TestGraphicsExpose) ... ok
> testUnpack0 (test.test_events_le.TestGraphicsExpose) ... ok
> testPack0 (test.test_events_le.TestGravityNotify) ... ok
> testUnpack0 (test.test_events_le.TestGravityNotify) ... ok
> testPack0 (test.test_events_le.TestKeymapNotify) ... ok
> testUnpack0 (test.test_events_le.TestKeymapNotify) ... ok
> testPack0 (test.test_events_le.TestMapNotify) ... ok
> testUnpack0 (test.test_events_le.TestMapNotify) ... ok
> testPack0 (test.test_events_le.TestMapRequest) ... ok
> testUnpack0 (test.test_events_le.TestMapRequest) ... ok
> testPack0 (test.test_events_le.TestMappingNotify) ... ok
> testUnpack0 (test.test_events_le.TestMappingNotify) ... ok
> testPack0 (test.test_events_le.TestNoExpose) ... ok
> testUnpack0 (test.test_events_le.TestNoExpose) ... ok
> testPack0 (test.test_events_le.TestPropertyNotify) ... ok
> testUnpack0 (test.test_events_le.TestPropertyNotify) ... ok
> testPack0 (test.test_events_le.TestReparentNotify) ... ok
> testUnpack0 (test.test_events_le.TestReparentNotify) ... ok
> testPack0 (test.test_events_le.TestResizeRequest) ... ok
> testUnpack0 (test.test_events_le.TestResizeRequest) ... ok
> testPack0 (test.test_events_le.TestSelectionClear) ... ok
> testUnpack0 (test.test_events_le.TestSelectionClear) ... ok
> testPack0 (test.test_events_le.TestSelectionNotify) ... ok
> testUnpack0 (test.test_events_le.TestSelectionNotify) ... 

Bug#966180: marked as done (nautilus-sendto: deprecated and unmaintained upstream)

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 17:33:16 +
with message-id 
and subject line Bug#1018798: Removed package(s) from unstable
has caused the Debian Bug report #966180,
regarding nautilus-sendto: deprecated and unmaintained upstream
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
966180: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=966180
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: nautilus-sendto
Severity: important
Tags: wontfix
User: pkg-gnome-maintain...@lists.alioth.debian.org
Usertags: oldlibs

nautilus-sendto is no longer maintained upstream, and has been deprecated
since 2019:
https://mail.gnome.org/archives/desktop-devel-list/2019-February/msg00057.html

It was recently moved to ,
and the most recent release, 3.8.6, was three years ago. I think we should
consider removing it from Debian bullseye.

nautilus and evince have historically had explicit support for sending
files through nautilus-sendto, which I suspect will be removed upstream
at some point if it wasn't already.

The only hard dependency appears to be in meta-gnome3 (dak output below).
Additionally, evince, gajim and nautilus have Suggests on it.

smcv



smcv@coccia ~ % dak rm -R -n nautilus-sendto
Will remove the following packages from unstable:

nautilus-sendto |3.8.6-3 | source, amd64, arm64, armel, armhf, i386, 
mips64el, mipsel, ppc64el, s390x

Maintainer: Debian GNOME Maintainers 


--- Reason ---

--

Checking reverse dependencies...
# Broken Depends:
meta-gnome3: gnome

Dependency problem found.
--- End Message ---
--- Begin Message ---
Version: 3.8.6-4+rm

Dear submitter,

as the package nautilus-sendto has just been removed from the Debian archive
unstable we hereby close the associated bug reports.  We are sorry
that we couldn't deal with your issue properly.

For details on the removal, please see https://bugs.debian.org/1018798

The version of this package that was in Debian prior to this removal
can still be found using http://snapshot.debian.org/.

Please note that the changes have been done on the master archive and
will not propagate to any mirrors until the next dinstall run at the
earliest.

This message was generated automatically; if you believe that there is
a problem with it please contact the archive administrators by mailing
ftpmas...@ftp-master.debian.org.

Debian distribution maintenance software
pp.
Thorsten Alteholz (the ftpmaster behind the curtain)--- End Message ---

Bug#970916: marked as done (vzctl: unusable without kernel support)

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 17:32:28 +
with message-id 
and subject line Bug#1018823: Removed package(s) from unstable
has caused the Debian Bug report #970916,
regarding vzctl: unusable without kernel support
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
970916: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=970916
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: vzctl
Version: 4.9.4-6
Severity: serious

vzctl needs kernel support, specifically the "vz" patches. Debian
hasn't shipped those in a long time. By now it appears upstream
development has moved back behind more closed doors, and it's
unlikely we'll see anything for bullseye.

Also, IIRC, the RHEL8-based kernel trees would need newer tooling,
not "vzctl". (Which also doesn't seem to be public.)

Continuing shipping vzctl will not help anyone.
I'll also file bugs against the related vzquota, vzstats programs.

Chris
--- End Message ---
--- Begin Message ---
Version: 4.9.4-6+rm

Dear submitter,

as the package vzctl has just been removed from the Debian archive
unstable we hereby close the associated bug reports.  We are sorry
that we couldn't deal with your issue properly.

For details on the removal, please see https://bugs.debian.org/1018823

The version of this package that was in Debian prior to this removal
can still be found using http://snapshot.debian.org/.

Please note that the changes have been done on the master archive and
will not propagate to any mirrors until the next dinstall run at the
earliest.

This message was generated automatically; if you believe that there is
a problem with it please contact the archive administrators by mailing
ftpmas...@ftp-master.debian.org.

Debian distribution maintenance software
pp.
Thorsten Alteholz (the ftpmaster behind the curtain)--- End Message ---

Bug#980338: marked as done (hotswap: should ship with bullseye?)

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 17:30:37 +
with message-id 
and subject line Bug#1018826: Removed package(s) from unstable
has caused the Debian Bug report #980338,
regarding hotswap: should ship with bullseye?
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
980338: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=980338
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: hotswap
Priority: important

hotswap is software for managing IDE drives, relying on the old
CONFIG_IDE=y IDE subsystem in the kernel. This was designed for
Linux kernel series 2.4.

On no Debian release architecture any current kernel enables
CONFIG_IDE. Therefore, in a normal Debian setup, this package cannot
be used.
Users of non-release architectures can always take this from
unstable, which I guess they would need to do anyway.

Should it be shipped with bullseye, then?

I'll consider raising priority of this bug over time, probably
rather quick.

Chris
--- End Message ---
--- Begin Message ---
Version: 0.4.0-15.1+rm

Dear submitter,

as the package hotswap has just been removed from the Debian archive
unstable we hereby close the associated bug reports.  We are sorry
that we couldn't deal with your issue properly.

For details on the removal, please see https://bugs.debian.org/1018826

The version of this package that was in Debian prior to this removal
can still be found using http://snapshot.debian.org/.

Please note that the changes have been done on the master archive and
will not propagate to any mirrors until the next dinstall run at the
earliest.

This message was generated automatically; if you believe that there is
a problem with it please contact the archive administrators by mailing
ftpmas...@ftp-master.debian.org.

Debian distribution maintenance software
pp.
Thorsten Alteholz (the ftpmaster behind the curtain)--- End Message ---

Bug#970917: marked as done (vzquota: unusable without kernel support)

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 17:31:58 +
with message-id 
and subject line Bug#1018824: Removed package(s) from unstable
has caused the Debian Bug report #970917,
regarding vzquota: unusable without kernel support
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
970917: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=970917
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: vzquota
Version: 3.1-4
Severity: serious

vzquota needs kernel support, specifically the "vz" patches. Debian
hasn't shipped those in a long time. By now it appears upstream
development has moved back behind more closed doors, and it's
unlikely we'll see anything for bullseye.

Continuing shipping vzquota will not help anyone.

See #970916 for the vzctl bug.

Chris
--- End Message ---
--- Begin Message ---
Version: 3.1-4+rm

Dear submitter,

as the package vzquota has just been removed from the Debian archive
unstable we hereby close the associated bug reports.  We are sorry
that we couldn't deal with your issue properly.

For details on the removal, please see https://bugs.debian.org/1018824

The version of this package that was in Debian prior to this removal
can still be found using http://snapshot.debian.org/.

Please note that the changes have been done on the master archive and
will not propagate to any mirrors until the next dinstall run at the
earliest.

This message was generated automatically; if you believe that there is
a problem with it please contact the archive administrators by mailing
ftpmas...@ftp-master.debian.org.

Debian distribution maintenance software
pp.
Thorsten Alteholz (the ftpmaster behind the curtain)--- End Message ---

Bug#1009915: sysvinit: Please align with manpages-l10n and afterwards activate man page translations

[Mark Hindley]

Andreas,

On Tue Aug 30 23:05:59 2022 Andreas Beckmann  wrote:
> Followup-For: Bug #1009915
> Control: found -1 3.05-1
> 
> Hi,
> 
> there seems to be one manpage (in bootlogd) missing conflict handling:
> 
> /usr/share/man/fr/man8/bootlogd.8.gz

Thanks. I was under the impression that manpages-i10n had changed to systemd 
versions (which doesn't have bootlogd.8) but apparently not. I think  we should 
continue to use the manpages-i10n version and not have any more dpkg diversions 
than are absolutely necessary. 

I am away for a week, but will resolve this once I am back.

Mark

Bug#1017274: marked as done (kxd: FTBFS: dwz: debian/kxd/usr/bin/kxd: Found compressed .debug_abbrev section, not attempting dwz compression)

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 15:34:02 +
with message-id 
and subject line Bug#1017274: fixed in kxd 0.15-4
has caused the Debian Bug report #1017274,
regarding kxd: FTBFS: dwz: debian/kxd/usr/bin/kxd: Found compressed 
.debug_abbrev section, not attempting dwz compression
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1017274: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1017274
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: kxd
Version: 0.15-3
Severity: serious
Justification: FTBFS
Tags: bookworm sid ftbfs
User: lu...@debian.org
Usertags: ftbfs-20220813 ftbfs-bookworm

Hi,

During a rebuild of all packages in sid, your package failed to build
on amd64.


Relevant part (hopefully):
> make[1]: Entering directory '/<>'
> dh_install
> [ -d debian/kxc/usr/share/doc/kxc ] || \
> mkdir -p debian/kxc/usr/share/doc/kxc
> cp cryptsetup/README debian/kxc/usr/share/doc/kxc/cryptsetup.README
> make[1]: Leaving directory '/<>'
>dh_installdocs
>dh_installchangelogs
>dh_installman
>dh_installinit
>dh_installsystemd
>dh_installinitramfs
>dh_perl
>dh_link
>dh_strip_nondeterminism
>dh_compress
>dh_fixperms
>dh_missing
>dh_dwz -a
> dwz: dwz: debian/kxc/usr/bin/kxc: Found compressed .debug_abbrev section, not 
> attempting dwz compression
> debian/kxgencert/usr/bin/kxgencert: Found compressed .debug_abbrev section, 
> not attempting dwz compression
> dwz: debian/kxd/usr/bin/kxd: Found compressed .debug_abbrev section, not 
> attempting dwz compression
> dh_dwz: error: dwz -- debian/kxc/usr/bin/kxc returned exit code 1
> dh_dwz: error: dwz -- debian/kxgencert/usr/bin/kxgencert returned exit code 1
> dh_dwz: error: dwz -- debian/kxd/usr/bin/kxd returned exit code 1
> dh_dwz: error: Aborting due to earlier error
> make: *** [debian/rules:7: binary] Error 25


The full build log is available from:
http://qa-logs.debian.net/2022/08/13/kxd_0.15-3_unstable.log

All bugs filed during this archive rebuild are listed at:
https://bugs.debian.org/cgi-bin/pkgreport.cgi?tag=ftbfs-20220813;users=lu...@debian.org
or:
https://udd.debian.org/bugs/?release=na&merged=ign&fnewerval=7&flastmodval=7&fusertag=only&fusertagtag=ftbfs-20220813&fusertaguser=lu...@debian.org&allbugs=1&cseverity=1&ctags=1&caffected=1#results

A list of current common problems and possible solutions is available at
http://wiki.debian.org/qa.debian.org/FTBFS . You're welcome to contribute!

If you reassign this bug to another package, please marking it as 'affects'-ing
this package. See https://www.debian.org/Bugs/server-control#affects

If you fail to reproduce this, please provide a build log and diff it with mine
so that we can identify if something relevant changed in the meantime.
--- End Message ---
--- Begin Message ---
Source: kxd
Source-Version: 0.15-4
Done: Alberto Bertogli 

We believe that the bug you reported is fixed in the latest version of
kxd, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 1017...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Alberto Bertogli  (supplier of updated kxd package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Wed, 31 Aug 2022 12:33:04 +0100
Source: kxd
Architecture: source
Version: 0.15-4
Distribution: unstable
Urgency: medium
Maintainer: Maximiliano Curia 
Changed-By: Alberto Bertogli 
Closes: 1017274
Changes:
 kxd (0.15-4) unstable; urgency=medium
 .
   * Don't run dwz after build (Closes: #1017274)
   * Standards-Version: 4.6.1 (no changes needed)
Checksums-Sha1:
 3fd27e1d2dd29621205a6fc29d9189a8828dba53 1954 kxd_0.15-4.dsc
 e82b36d2d1e372182cc4a5a1f93a1be788d9a2f3 5024 kxd_0.15-4.debian.tar.xz
 85d968374bb6f33e033c975a1dfabe8be0e9032d 6984 kxd_0.15-4_source.buildinfo
Checksums-Sha256:
 295616f4e9ac230fba4f56cd1705b61634d19475f4e57f6cc4368c9816b54c93 1954 
kxd_0.15-4.dsc
 fc664532241666ab9878555f81224c558278190fbea8fa09e7468099c3aede56 5024 
kxd_0.15-4.debian.tar.xz
 13d8ea63b6b9ee55e20ab940379fff04d3b9f73a350c979e5403b9988b5a9201 6984 
kxd_0.15-4_source.buildinfo
Files:
 31c613287f71eb1e506beee747aa8fe7 1954 net optional kxd_0.15-4.d

Processed: bump severity of packages that won't work with Nautilus 43

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> severity 1017623 serious
Bug #1017623 [src:nautilus-filename-repairer] nautilus-filename-repairer: Fails 
to build with Nautilus 43
Severity set to 'serious' from 'important'
> severity 1017618 serious
Bug #1017618 [src:nautilus-share] nautilus-share: Incompatible with Nautilus 43
Severity set to 'serious' from 'important'
> severity 1017619 serious
Bug #1017619 [src:nautilus-wipe] nautilus-wipe: Fails to build with nautilus 43
Severity set to 'serious' from 'important'
> severity 1017621 serious
Bug #1017621 [src:seahorse-nautilus] seahorse-nautilus: Fails to build with 
Nautilus 43
Severity set to 'serious' from 'important'
> severity 1018090 serious
Bug #1018090 [nautilus-hide] nautilus-hide: Patch for compatibility with older 
python3-nautilus
Severity set to 'serious' from 'important'
> severity 1017576 serious
Bug #1017576 [src:nautilus-admin] nautilus-admin: Incompatible with Nautilus 43
Severity set to 'serious' from 'important'
>
End of message, stopping processing here.

Please contact me if you need assistance.
-- 
1017576: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1017576
1017618: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1017618
1017619: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1017619
1017621: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1017621
1017623: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1017623
1018090: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1018090
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#1015780: marked as done (casparcg-server: FTBFS with ffmpeg 5.0)

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 15:03:57 +
with message-id 
and subject line Bug#1015780: fixed in casparcg-server 2.3.3+dfsg-1
has caused the Debian Bug report #1015780,
regarding casparcg-server: FTBFS with ffmpeg 5.0
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1015780: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1015780
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: casparcg-server
Version: 2.2.0+dfsg-2.1
Severity: serious
Tags: patch
Justification: FTBFS
User: ubuntu-de...@lists.ubuntu.com
Usertags: origin-ubuntu kinetic ubuntu-patch

Hi Petter,

casparcg-server fails to build against ffmpeg 5.0 which is now in unstable. 
The attached patch fixes the API incompatibilities.

Other fixes are needed to get casparcg-server building in general; I believe
there are bugs open for these other issues.

-- 
Steve Langasek   Give me a lever long enough and a Free OS
Debian Developer   to set it on, and I can move the world.
Ubuntu Developer   https://www.debian.org/
slanga...@ubuntu.com vor...@debian.org
diff -Nru casparcg-server-2.2.0+dfsg/debian/control 
casparcg-server-2.2.0+dfsg/debian/control
--- casparcg-server-2.2.0+dfsg/debian/control   2022-03-09 03:13:39.0 
-0800
+++ casparcg-server-2.2.0+dfsg/debian/control   2022-07-20 21:42:59.0 
-0700
@@ -1,6 +1,5 @@
 Source: casparcg-server
-Maintainer: Ubuntu Developers 
-XSBC-Original-Maintainer: Petter Reinholdtsen 
+Maintainer: Petter Reinholdtsen 
 Section: contrib/video
 Priority: optional
 Standards-Version: 4.3.0
diff -Nru casparcg-server-2.2.0+dfsg/debian/patches/ffmpeg-5.0.patch 
casparcg-server-2.2.0+dfsg/debian/patches/ffmpeg-5.0.patch
--- casparcg-server-2.2.0+dfsg/debian/patches/ffmpeg-5.0.patch  1969-12-31 
16:00:00.0 -0800
+++ casparcg-server-2.2.0+dfsg/debian/patches/ffmpeg-5.0.patch  2022-07-20 
21:42:59.0 -0700
@@ -0,0 +1,182 @@
+Description: Compatibility with ffmpeg 5.0.
+Author: Steve Langasek 
+Last-Update: 2022-07-20
+Forwarded: no
+
+Index: casparcg-server-2.2.0+dfsg/src/modules/ffmpeg/producer/av_producer.cpp
+===
+--- casparcg-server-2.2.0+dfsg.orig/src/modules/ffmpeg/producer/av_producer.cpp
 casparcg-server-2.2.0+dfsg/src/modules/ffmpeg/producer/av_producer.cpp
+@@ -38,6 +38,7 @@
+ #include 
+ #include 
+ #include 
++#include 
+ #include 
+ #include 
+ #include 
+Index: casparcg-server-2.2.0+dfsg/src/modules/ffmpeg/util/av_util.cpp
+===
+--- casparcg-server-2.2.0+dfsg.orig/src/modules/ffmpeg/util/av_util.cpp
 casparcg-server-2.2.0+dfsg/src/modules/ffmpeg/util/av_util.cpp
+@@ -9,7 +9,9 @@
+ extern "C" {
+ #include 
+ #include 
++#include 
+ #include 
++#include 
+ #include 
+ }
+ #if defined(_MSC_VER)
+@@ -113,46 +115,52 @@
+ core::pixel_format_desc pixel_format_desc(AVPixelFormat pix_fmt, int width, 
int height)
+ {
+ // Get linesizes
+-AVPicture dummy_pict;
+-avpicture_fill(&dummy_pict, nullptr, pix_fmt, width, height);
++uint8_t *pointers[4];
++int linesize[4];
++av_image_alloc(pointers, linesize, width, height, pix_fmt, 8);
+ 
+ core::pixel_format_desc desc = get_pixel_format(pix_fmt);
+ 
+ switch (desc.format) {
+ case core::pixel_format::gray:
+ case core::pixel_format::luma: {
+-
desc.planes.push_back(core::pixel_format_desc::plane(dummy_pict.linesize[0], 
height, 1));
++desc.planes.push_back(core::pixel_format_desc::plane(linesize[0], 
height, 1));
++av_freep(&pointers[0]);
+ return desc;
+ }
+ case core::pixel_format::bgr:
+ case core::pixel_format::rgb: {
+-
desc.planes.push_back(core::pixel_format_desc::plane(dummy_pict.linesize[0] / 
3, height, 3));
++desc.planes.push_back(core::pixel_format_desc::plane(linesize[0] 
/ 3, height, 3));
++av_freep(&pointers[0]);
+ return desc;
+ }
+ case core::pixel_format::bgra:
+ case core::pixel_format::argb:
+ case core::pixel_format::rgba:
+ case core::pixel_format::abgr: {
+-
desc.planes.push_back(core::pixel_format_desc::plane(dummy_pict.linesize[0] / 
4, height, 4));
++desc.planes.push_back(core::pixel_format_desc::plane(linesize[0] 
/ 4, height, 4));
++av_freep(&pointers[0]);
+ return desc;
+ }
+ case core::p

Bug#1018834: marked as done (node-browserify-lite: bundt incompatible with node-terser >= 5)

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 14:36:00 +
with message-id 
and subject line Bug#1018834: fixed in node-browserify-lite 0.5.1+~cs7.1.5-3
has caused the Debian Bug report #1018834,
regarding node-browserify-lite: bundt incompatible with node-terser >= 5
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1018834: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1018834
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: node-browserify-lite
Version: 0.5.1+~cs7.1.5-2
Severity: serious
Tags: ftbfs
Justification: ftbfs

bundt requires terser ^4.8. It should be updated to use node-terser >= 5
--- End Message ---
--- Begin Message ---
Source: node-browserify-lite
Source-Version: 0.5.1+~cs7.1.5-3
Done: Yadd 

We believe that the bug you reported is fixed in the latest version of
node-browserify-lite, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 1018...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Yadd  (supplier of updated node-browserify-lite package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Wed, 31 Aug 2022 16:13:15 +0200
Source: node-browserify-lite
Built-For-Profiles: nocheck
Architecture: source
Version: 0.5.1+~cs7.1.5-3
Distribution: unstable
Urgency: medium
Maintainer: Debian Javascript Maintainers 

Changed-By: Yadd 
Closes: 1018834
Changes:
 node-browserify-lite (0.5.1+~cs7.1.5-3) unstable; urgency=medium
 .
   * Team upload
 .
   [ Pirate Praveen ]
   * Update minimum version of dh-sequence-nodejs for pkgjs-pjson
 .
   [ Yadd ]
   * Declare compliance with policy 4.6.1
   * Add fix for terser >= 5 (Closes: #1018834)
Checksums-Sha1: 
 ad661ed52592ea31be7124688be3005e76071969 3304 
node-browserify-lite_0.5.1+~cs7.1.5-3.dsc
 8fab8c3a14e69fb5a57fd26249025e3f6a886c25 6192 
node-browserify-lite_0.5.1+~cs7.1.5-3.debian.tar.xz
Checksums-Sha256: 
 ea52d26c556c195466f2bd7eb2cb17b917754b463c75e0f8b8cceea9a97c3013 3304 
node-browserify-lite_0.5.1+~cs7.1.5-3.dsc
 7c158d700e14a46c90c2d77e38bd7da9118c76859b1302d6ae0e9d6dc786a833 6192 
node-browserify-lite_0.5.1+~cs7.1.5-3.debian.tar.xz
Files: 
 e81eb09bc7e2b8042498b93ad6ddfd2d 3304 javascript optional 
node-browserify-lite_0.5.1+~cs7.1.5-3.dsc
 4e956f860f8a60d1d429640651f8a123 6192 javascript optional 
node-browserify-lite_0.5.1+~cs7.1.5-3.debian.tar.xz

-BEGIN PGP SIGNATURE-

iQIzBAEBCgAdFiEEAN/li4tVV3nRAF7J9tdMp8mZ7ukFAmMPbTkACgkQ9tdMp8mZ
7unYkg/+LukCUj5bRBFZeUxXIpfLhbdaa7X+BaghRYycPolYnVHw6AGkMecOd9zR
DP1LhEZ/aJgfKB5RwikBC/AjDj2w4swZQywzYR1+BN9Frwane4eTb5yM0lwo8j+Y
94reHtqTl2/JOlzA1KDmkn78t6bTj6z/N1jq5BYbUHdRQCB1FyhipylDgn1VEcu2
T6XeGmv6afmDlPVYC9YinAje8h7li6mscQ8iXYd6JXsGCIrJll4PULAIliySEOWg
V6DcqPbZUNiejBMvnXhhWWkk0X44rZVA2p47svVGT4vj8loLHq5riNqHhcN1Rgh9
5Th7Oe6SSjsvf9hnrchtpFb4bhRBqehOx9VGcd4fp3fF3LGrjhLO+jfUAKlbKAHZ
dMMKtullTSQMa1Q8bQ6rZkseKyeghP7jF3REgl3WKIHWwUZSsdx0IOVxVr9Fs9+0
8EG6kCHqs+sq+vGgmCjqz230IaYEsWoJhcfN3TGm/lNod86gLPJtlqkjyNt2ni8f
FXhTbQK/8CJDvYtEz4M1/IpH/M4BRDWTxpzOeXiCYmySmpTF+7UYQYGd1brfmEGu
6hRSn6jOx3KE/HMCP+1Cq+xRraPZthcWSmYlVWf5ktmThWcV1ZzyQBN6zajZC08E
g4HRzo+bKh5gytcOa1cFyiR57NOWJhNBsjtzoiS2GWGvULac5j8=
=vKrw
-END PGP SIGNATURE End Message ---

Processed: affects 1018834

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> affects 1018834 src:node-jest
Bug #1018834 [node-browserify-lite] node-browserify-lite: bundt incompatible 
with node-terser >= 5
Added indication that 1018834 affects src:node-jest
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
1018834: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1018834
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Processed: Bug#1018834 marked as pending in node-browserify-lite

[Debian Bug Tracking System]

Processing control commands:

> tag -1 pending
Bug #1018834 [node-browserify-lite] node-browserify-lite: bundt incompatible 
with node-terser >= 5
Added tag(s) pending.

-- 
1018834: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1018834
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#1018834: marked as pending in node-browserify-lite

[Yadd]

Control: tag -1 pending

Hello,

Bug #1018834 in node-browserify-lite reported by you has been fixed in the
Git repository and is awaiting an upload. You can see the commit
message below and you can check the diff of the fix at:

https://salsa.debian.org/js-team/node-browserify-lite/-/commit/c8e9de60422d56a4932f7437e8504dc0f1fd0dc6


Add fix for terser >= 5

Closes: #1018834


(this message was generated automatically)
-- 
Greetings

https://bugs.debian.org/1018834

Bug#1015108: marked as done (datalad-container: FTBFS: ModuleNotFoundError: No module named 'pytest')

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 09:36:07 -0400
with message-id 
and subject line Re: Bug#1015108: datalad-container: FTBFS: 
ModuleNotFoundError: No module named 'pytest'
has caused the Debian Bug report #1015108,
regarding datalad-container: FTBFS: ModuleNotFoundError: No module named 
'pytest'
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1015108: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1015108
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: datalad-container
Version: 1.1.6-0.1
Severity: serious
Justification: FTBFS
Tags: bookworm sid ftbfs
User: lu...@debian.org
Usertags: ftbfs-20220716 ftbfs-bookworm

Hi,

During a rebuild of all packages in sid, your package failed to build
on amd64.


Relevant part (hopefully):
> make[1]: Entering directory '/<>'
> py3versions: no X-Python3-Version in control file, using supported versions
> dh_auto_install
> I: pybuild base:239: /usr/bin/python3.9 setup.py install --root 
> /<>/debian/datalad-container 
> running install
> /usr/lib/python3/dist-packages/setuptools/command/install.py:34: 
> SetuptoolsDeprecationWarning: setup.py install is deprecated. Use build and 
> pip and other standards-based tools.
>   warnings.warn(
> running build
> running build_py
> running egg_info
> writing datalad_container.egg-info/PKG-INFO
> writing dependency_links to datalad_container.egg-info/dependency_links.txt
> writing entry points to datalad_container.egg-info/entry_points.txt
> writing requirements to datalad_container.egg-info/requires.txt
> writing top-level names to datalad_container.egg-info/top_level.txt
> reading manifest file 'datalad_container.egg-info/SOURCES.txt'
> reading manifest template 'MANIFEST.in'
> warning: no files found matching 'LICENSE'
> no previously-included directories found matching 'docs/build'
> adding license file 'COPYING'
> writing manifest file 'datalad_container.egg-info/SOURCES.txt'
> UPDATING 
> /<>/.pybuild/cpython3_3.9_datalad-container/build/datalad_container/_version.py
> set 
> /<>/.pybuild/cpython3_3.9_datalad-container/build/datalad_container/_version.py
>  to '1.1.6'
> running install_lib
> creating /<>/debian/datalad-container/usr
> creating /<>/debian/datalad-container/usr/lib
> creating /<>/debian/datalad-container/usr/lib/python3.9
> creating 
> /<>/debian/datalad-container/usr/lib/python3.9/dist-packages
> creating 
> /<>/debian/datalad-container/usr/lib/python3.9/dist-packages/datalad_container
> copying 
> /<>/.pybuild/cpython3_3.9_datalad-container/build/datalad_container/__init__.py
>  -> 
> /<>/debian/datalad-container/usr/lib/python3.9/dist-packages/datalad_container
> creating 
> /<>/debian/datalad-container/usr/lib/python3.9/dist-packages/datalad_container/adapters
> copying 
> /<>/.pybuild/cpython3_3.9_datalad-container/build/datalad_container/adapters/__init__.py
>  -> 
> /<>/debian/datalad-container/usr/lib/python3.9/dist-packages/datalad_container/adapters
> copying 
> /<>/.pybuild/cpython3_3.9_datalad-container/build/datalad_container/adapters/docker.py
>  -> 
> /<>/debian/datalad-container/usr/lib/python3.9/dist-packages/datalad_container/adapters
> creating 
> /<>/debian/datalad-container/usr/lib/python3.9/dist-packages/datalad_container/adapters/tests
> copying 
> /<>/.pybuild/cpython3_3.9_datalad-container/build/datalad_container/adapters/tests/__init__.py
>  -> 
> /<>/debian/datalad-container/usr/lib/python3.9/dist-packages/datalad_container/adapters/tests
> copying 
> /<>/.pybuild/cpython3_3.9_datalad-container/build/datalad_container/adapters/tests/test_docker.py
>  -> 
> /<>/debian/datalad-container/usr/lib/python3.9/dist-packages/datalad_container/adapters/tests
> copying 
> /<>/.pybuild/cpython3_3.9_datalad-container/build/datalad_container/definitions.py
>  -> 
> /<>/debian/datalad-container/usr/lib/python3.9/dist-packages/datalad_container
> copying 
> /<>/.pybuild/cpython3_3.9_datalad-container/build/datalad_container/containers_add.py
>  -> 
> /<>/debian/datalad-container/usr/lib/python3.9/dist-packages/datalad_container
> copying 
> /<>/.pybuild/cpython3_3.9_datalad-container/build/datalad_container/find_container.py
>  -> 
> /<>/debian/datalad-container/usr/lib/python3.9/dist-packages/datalad_container
> copying 
> /<>/.pybuild/cpython3_3.9_datalad-container/build/datalad_container/containers_remove.py
>  -> 
> /<>/debian/datalad-container/usr/lib/python3.9/dist-packages/datalad_container
> copying 
> /<>/.pybuild/cpython3_3.9_datalad-container/build/datalad_container/containers_run.py
>  -> 
> /<>/debian/datalad-container/usr/lib/python3.9/dist-packages/d

Bug#1018678: marked as done (abseil: FTBFS on ppc64el)

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 09:42:11 -0400
with message-id 

and subject line Re: abseil: FTBFS on ppc64el
has caused the Debian Bug report #1018678,
regarding abseil: FTBFS on ppc64el
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1018678: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1018678
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: abseil
Version: 0~20220623.0-1
Severity: serious
Tags: ftbfs
Justification: fails to build from source (but built successfully in the past)
X-Debbugs-Cc: sramac...@debian.org

https://buildd.debian.org/status/fetch.php?pkg=abseil&arch=ppc64el&ver=0%7E20220623.0-1&stamp=1661712847&raw=0

151: [ RUN  ] CordzSampleTokenTest.Iterator
151: [   OK ] CordzSampleTokenTest.Iterator (0 ms)
151: [ RUN  ] CordzSampleTokenTest.IteratorEquality
151: [   OK ] CordzSampleTokenTest.IteratorEquality (0 ms)
151: [ RUN  ] CordzSampleTokenTest.MultiThreaded
150: [mutex.cc : 1682] RAW: Mutex unlocked when destroyed or not locked: v=0x0
148/182 Test #150: absl_cordz_info_statistics_test 
Subprocess aborted***Exception:   0.49 sec
Running main() from gmock_main.cc

Cheers
-- 
Sebastian Ramacher
--- End Message ---
--- Begin Message ---
Version: 0~20220623.0-2--- End Message ---

Bug#1018834: node-browserify-lite: bundt incompatible with node-terser >= 5

[Yadd]

Package: node-browserify-lite
Version: 0.5.1+~cs7.1.5-2
Severity: serious
Tags: ftbfs
Justification: ftbfs

bundt requires terser ^4.8. It should be updated to use node-terser >= 5

Bug#1017033: marked as done (scotch: autopkgtest regression on armel, armhf and ppc64el with glibc 2.34: output on stderr)

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 13:05:24 +
with message-id 
and subject line Bug#1017033: fixed in scotch 7.0.1-3
has caused the Debian Bug report #1017033,
regarding scotch: autopkgtest regression on armel, armhf and ppc64el with glibc 
2.34: output on stderr
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1017033: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1017033
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---

Source: scotch
Version: 7.0.1-2
Severity: serious
User: debian...@lists.debian.org
Usertags: regression

Dear maintainer(s),

I looked at the results of the autopkgtest of you package because it was 
showing up as a regression for the upload of glibc [0] on armel, armhf 
and ppc64el. It seems that it fails due to *warnings* printed on stderr. 
autopkgtest by default fails on output to stderr, which can be changed 
by adding a "allow-stderr" restriction to the test. Obviously it's 
better to prevent the output. Ubuntu already added the restriction 
because they were seeing this before Debian.


Because the unstable-to-testing migration software now blocks on
regressions in testing, flaky tests, i.e. tests that flip between
passing and failing without changes to the list of installed packages,
are causing people unrelated to your package to spend time on these
tests.

Don't hesitate to reach out if you need help and some more information
from our infrastructure.

Paul

[0] 
https://ci.debian.net/data/autopkgtest/testing/armel/s/scotch/24593514/log.gz


autopkgtest [17:58:43]: test test-scotch:  - - - - - - - - - - stderr - 
- - - - - - - - -

test_scotch_graph_induce.c: In function ‘main’:
test_scotch_graph_induce.c:134:3: warning: ‘memset’ specified size 
between 2147483649 and 4294967295 exceeds maximum object size 2147483647 
[-Wstringop-overflow=]

  134 |   memset (orgparttab, 0, orgvertnbr * sizeof (SCOTCH_GraphPart2));
  |   ^~~


OpenPGP_signature
Description: OpenPGP digital signature
--- End Message ---
--- Begin Message ---
Source: scotch
Source-Version: 7.0.1-3
Done: Drew Parsons 

We believe that the bug you reported is fixed in the latest version of
scotch, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 1017...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Drew Parsons  (supplier of updated scotch package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

Format: 1.8
Date: Wed, 31 Aug 2022 14:24:01 +0200
Source: scotch
Architecture: source
Version: 7.0.1-3
Distribution: unstable
Urgency: medium
Maintainer: Debian Science Maintainers 

Changed-By: Drew Parsons 
Closes: 1017033
Changes:
 scotch (7.0.1-3) unstable; urgency=medium
 .
   * Team upload.
   * debian/tests Restrictions: allow-stderr. glibc 2.34 prints memset
 warning messages to stderr. Closes: #1017033.
 See https://gitlab.inria.fr/scotch/scotch/-/issues/18
   * Standards-Version: 4.6.1
Checksums-Sha1:
 d1b90e4b8f83c95fe1a2eed5eb3294695d038996 2575 scotch_7.0.1-3.dsc
 edf70658069aa903860f91adb85f8192e5f2c320 20716 scotch_7.0.1-3.debian.tar.xz
Checksums-Sha256:
 3809dd6866abbe4fd1a940fb73f755bd74e6cd97c37f0100517f7f1357b6a3b9 2575 
scotch_7.0.1-3.dsc
 661c479a3a333c370c4ee2820d8f1c895c3dd6064e2bd0ad53c72c97322ee07d 20716 
scotch_7.0.1-3.debian.tar.xz
Files:
 64effd97bbc224a22482e70f396c8c2f 2575 math optional scotch_7.0.1-3.dsc
 ac1a8e0b63f81720a494f9890543bec2 20716 math optional 
scotch_7.0.1-3.debian.tar.xz

-BEGIN PGP SIGNATURE-

iQIzBAEBCAAdFiEEI8mpPlhYGekSbQo2Vz7x5L1aAfoFAmMPWIQACgkQVz7x5L1a
Afrp7Q//Q0wlk7FYm/daqkRjGoqzCcEchhHUfa6pM27E38Qz71Xx5ep0uwZqlNe/
Smbu3LmATBZjgPuREs9zKEzbSbsy1MHqrljJpima2VQQTcQjADMtdMaQHh3lLyIV
ONytz6vOkv53lumojqjxzAk3SqA9VBvE5a1naJJtUmuzU1/Ee/c9lysiqAPtDWfu
n9E3zO/tGQac4cZ94xrGlujw+7hbFPHFIZkoIbd76Nhv42ubrGk3NGbvLUolBgQa
B9W6tNOBZfqns5pMOzugF3O/YZrebd2AiXhYRBALuYtlAqmx47OMXuZc5ce4bXqy
s4Tp8e5CLXdCWg7f0P+9LsuzX9YOXUjZY/sCU0fcAAOniQ5xkrGIOenq1NOIUi2J
/RgCElySVMHzi+0XWTAjiC6gBBWt/PUovWXG/mh77XM0/1asvSwC8IppCiEl6vD4
Dq38oBEZsAjjVwB/mLjXmNHSLNOmcS99TDbnr+keQiqE6rnZ+66IIqyZqzk6j/9F
BsIoU18Uiip5Sn5CkIXmoUj7hOYwxXRrPHJAe

Bug#1017356: libpmix2: symbol lookup error: undefined symbol: pmix_value_load

[Drew Parsons]

The 4.1.2 workaround will want the pandoc drop patched in from 4.2.0 to 
build on the minor arches.

Bug#1017181: marked as done (gmerlin-avdecoder: FTBFS: demux_ffmpeg.c:535:45: error: ‘AVCodecParameters’ has no member named ‘bits_per_sample’; did you mean ‘bits_per_raw_sample’?)

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 11:48:57 +
with message-id 
and subject line Bug#1017181: fixed in gmerlin-avdecoder 2.0.0~svn6298~dfsg0-3
has caused the Debian Bug report #1017181,
regarding gmerlin-avdecoder: FTBFS: demux_ffmpeg.c:535:45: error: 
‘AVCodecParameters’ has no member named ‘bits_per_sample’; did you mean 
‘bits_per_raw_sample’?
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1017181: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1017181
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: gmerlin-avdecoder
Version: 2.0.0~svn6298~dfsg0-2
Severity: serious
Justification: FTBFS
Tags: bookworm sid ftbfs
User: lu...@debian.org
Usertags: ftbfs-20220813 ftbfs-bookworm

Hi,

During a rebuild of all packages in sid, your package failed to build
on amd64.


Relevant part (hopefully):
> /bin/bash ../libtool  --tag=CC   --mode=compile gcc -DHAVE_CONFIG_H -I. 
> -I../include  -I../include -Wdate-time -D_FORTIFY_SOURCE=2  
> -DLOCALE_DIR=\"/usr/share/locale\" "-I/usr/include" -D__BGAV__  
> -fvisibility=hidden -O3 -ffast-math -I/usr/include -I/usr/include/opus 
> -I/usr/include -I/usr/include/x86_64-linux-gnu 
> -I/usr/include/x86_64-linux-gnu  -g -O2 
> -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat 
> -Werror=format-security -D_REENTRANT -D_FILE_OFFSET_BITS=64  -Wall 
> -Wmissing-declarations -Wdeclaration-after-statement -c -o audio_flac.lo 
> audio_flac.c
> demux_ffmpeg.c: In function ‘get_format’:
> demux_ffmpeg.c:187:10: warning: return discards ‘const’ qualifier from 
> pointer target type [-Wdiscarded-qualifiers]
>   187 |   return av_probe_input_format(&avpd, 1);
>   |  ^~~
> demux_ffmpeg.c: In function ‘init_audio_stream’:
> demux_ffmpeg.c:535:45: error: ‘AVCodecParameters’ has no member named 
> ‘bits_per_sample’; did you mean ‘bits_per_raw_sample’?
>   535 | s->data.audio.bits_per_sample = params->bits_per_sample;
>   | ^~~
>   | bits_per_raw_sample
> demux_ffmpeg.c:544:5: warning: ‘channels’ is deprecated 
> [-Wdeprecated-declarations]
>   544 | s->data.audio.block_align = ((map->bits + 7) / 8) * 
> params->channels;
>   | ^
> In file included from 
> /usr/include/x86_64-linux-gnu/libavformat/avformat.h:314,
>  from demux_ffmpeg.c:26:
> /usr/include/x86_64-linux-gnu/libavcodec/codec_par.h:172:14: note: declared 
> here
>   172 | int  channels;
>   |  ^~~~
> demux_ffmpeg.c:549:3: warning: ‘channels’ is deprecated 
> [-Wdeprecated-declarations]
>   549 |   s->data.audio.format->num_channels = params->channels;
>   |   ^
> /usr/include/x86_64-linux-gnu/libavcodec/codec_par.h:172:14: note: declared 
> here
>   172 | int  channels;
>   |  ^~~~
> demux_ffmpeg.c: In function ‘init_video_stream’:
> demux_ffmpeg.c:618:33: error: ‘AVCodecParameters’ has no member named 
> ‘bits_per_sample’; did you mean ‘bits_per_raw_sample’?
>   618 |   s->data.video.depth = params->bits_per_sample;
>   | ^~~
>   | bits_per_raw_sample
> demux_ffmpeg.c: In function ‘next_packet_ffmpeg’:
> demux_ffmpeg.c:872:50: warning: passing argument 3 of 
> ‘av_packet_get_side_data’ from incompatible pointer type 
> [-Wincompatible-pointer-types]
>   872 |  &pal_i_len))
>   |  ^~
>   |  |
>   |  int *
> In file included from 
> /usr/include/x86_64-linux-gnu/libavformat/avformat.h:316:
> /usr/include/x86_64-linux-gnu/libavcodec/packet.h:604:42: note: expected 
> ‘size_t *’ {aka ‘long unsigned int *’} but argument is of type ‘int *’
>   604 |  size_t *size);
>   |  ^~~~
> make[3]: *** [Makefile:1594: demux_ffmpeg.lo] Error 1


The full build log is available from:
http://qa-logs.debian.net/2022/08/13/gmerlin-avdecoder_2.0.0~svn6298~dfsg0-2_unstable.log

All bugs filed during this archive rebuild are listed at:
https://bugs.debian.org/cgi-bin/pkgreport.cgi?tag=ftbfs-20220813;users=lu...@debian.org
or:
https://udd.debian.org/bugs/?release=na&merged=ign&fnewerval=7&flastmodval=7&fusertag=only&fusertagtag=ftbfs-20220813&fusertaguser=lu...@debian.org&allbugs=1&cseverity=1&ctag

Bug#1018813: marked as done (pkgconf-bin: removal of pkgconf-bin makes files disappear from pkgconf)

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 11:34:20 +
with message-id 
and subject line Bug#1018813: fixed in pkgconf 1.8.0-4
has caused the Debian Bug report #1018813,
regarding pkgconf-bin: removal of pkgconf-bin makes files disappear from pkgconf
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1018813: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1018813
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: pkgconf-bin
Version: 1.8.0-2
Severity: serious
User: debian...@lists.debian.org
Usertags: piuparts replaces-without-breaks
Control: affects -1 + pkgconf

Hi,

during a test with piuparts and DOSE tools I noticed your package causes
removal of files that also belong to another package.
This is caused by using Replaces without corresponding Breaks.

The installation sequence to reproduce this problem is

  apt-get install pkgconf/testing
  # (1)
  apt-get install pkgconf-bin/sid
  apt-get remove pkgconf-bin
  # (2)

The list of installed files at points (1) and (2) should be identical,
but the following files have disappeared:

  /usr/bin/pkgconf

This is a serious bug violating policy 7.6, see
https://www.debian.org/doc/debian-policy/ch-relationships.html#overwriting-files-and-replacing-packages-replaces
and also see the footnote that describes this incorrect behavior:
https://www.debian.org/doc/debian-policy/ch-relationships.html#id13

The pkgconf-bin package has the following relationships with pkgconf:

  Conflicts: n/a
  Breaks:n/a
  Replaces:  pkgconf (<< 1.8.0-2~)

>From the attached log (scroll to the bottom...):

0m31.4s ERROR: FAIL: After purging files have disappeared:
  /usr/bin/pkgconf   owned by: pkgconf-bin

0m31.4s ERROR: FAIL: After purging files have been modified:
  /var/lib/dpkg/info/pkgconf.listnot owned


cheers,

Andreas


pkgconf=1.8.0-1_pkgconf-bin=1.8.0-3.log.gz
Description: application/gzip
--- End Message ---
--- Begin Message ---
Source: pkgconf
Source-Version: 1.8.0-4
Done: Andrej Shadura 

We believe that the bug you reported is fixed in the latest version of
pkgconf, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 1018...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Andrej Shadura  (supplier of updated pkgconf package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

Format: 1.8
Date: Wed, 31 Aug 2022 13:18:21 +0200
Source: pkgconf
Architecture: source
Version: 1.8.0-4
Distribution: unstable
Urgency: medium
Maintainer: Andrej Shadura 
Changed-By: Andrej Shadura 
Closes: 1018813
Changes:
 pkgconf (1.8.0-4) unstable; urgency=medium
 .
   * Declare Breaks against non-split pkgconf package (Closes: #1018813).
Checksums-Sha1:
 bcec7e4018a1bbdf7e98843647c86544180163d6 1513 pkgconf_1.8.0-4.dsc
 35f1a94e377630530208648c3d8b59962db71373 8496 pkgconf_1.8.0-4.debian.tar.xz
Checksums-Sha256:
 ae6082c287e6f1fb7fc45d24ae5f215b24cbaa6902cab078ceb4b97297ffd72b 1513 
pkgconf_1.8.0-4.dsc
 403a35144cbc236c531ba50a8040603e2840b1779ccc45ab2fb9ff6762bd34ac 8496 
pkgconf_1.8.0-4.debian.tar.xz
Files:
 22383281bcbbfe0b20987984d0e681f4 1513 devel optional pkgconf_1.8.0-4.dsc
 a62af31ceeb9ea1012ef26a34b4687da 8496 devel optional 
pkgconf_1.8.0-4.debian.tar.xz

-BEGIN PGP SIGNATURE-

iHUEARYIAB0WIQSD3NF/RLIsyDZW7aHoRGtKyMdyYQUCYw9DnwAKCRDoRGtKyMdy
YdKKAP4mEKjbe3lrVmjDPiR29EEVeNwuOQbi0al0fKEkwnUHegD/ckDwECpRJFLV
V20VNbNVsuEB0y+YgFm7d3OJwO9HVA8=
=MFgf
-END PGP SIGNATURE End Message ---

Processed: Bug#1017274 marked as pending in kxd

[Debian Bug Tracking System]

Processing control commands:

> tag -1 pending
Bug #1017274 [src:kxd] kxd: FTBFS: dwz: debian/kxd/usr/bin/kxd: Found 
compressed .debug_abbrev section, not attempting dwz compression
Added tag(s) pending.

-- 
1017274: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1017274
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#1017274: marked as pending in kxd

[Alberto Bertogli]

Control: tag -1 pending

Hello,

Bug #1017274 in kxd reported by you has been fixed in the
Git repository and is awaiting an upload. You can see the commit
message below and you can check the diff of the fix at:

https://salsa.debian.org/debian/kxd/-/commit/d1348471769b27e0770c3b892476fd286447f804


Don't run dwz after build (Closes: #1017274)

dwz does not properly support Go, and will fail on binaries built with Go 1.19.

This patch makes the build system skip the dwz step. This is the same
workaround used by the chasquid package.

This fixes FTBFS bug #1017274
(https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1017274).


(this message was generated automatically)
-- 
Greetings

https://bugs.debian.org/1017274

Processed: Re: Bug#1011951: python-gevent: Build-Depends: libpython3.9-testsuite

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> tag 1011951 pending
Bug #1011951 [src:python-gevent] python-gevent: Build-Depends: 
libpython3.9-testsuite
Added tag(s) pending.
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
1011951: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1011951
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#1011951: python-gevent: Build-Depends: libpython3.9-testsuite

[Emanuele Rocca]

tag 1011951 pending
thanks

Fixed in git:
https://salsa.debian.org/python-team/packages/python-gevent/-/blob/9fc8b389269f5d6415ef1019e81e2a458667829b/debian/changelog

Bug#1017181: marked as pending in gmerlin-avdecoder

[IOhannes zmölnig]

Control: tag -1 pending

Hello,

Bug #1017181 in gmerlin-avdecoder reported by you has been fixed in the
Git repository and is awaiting an upload. You can see the commit
message below and you can check the diff of the fix at:

https://salsa.debian.org/multimedia-team/gmerlin-avdecoder/-/commit/8288b49fce96cd14560c1211943997083092a5a5


Patch to fix FTBFS with newer FFmpeg versions

Closes: #1017181


(this message was generated automatically)
-- 
Greetings

https://bugs.debian.org/1017181

Processed: Bug#1017181 marked as pending in gmerlin-avdecoder

[Debian Bug Tracking System]

Processing control commands:

> tag -1 pending
Bug #1017181 [src:gmerlin-avdecoder] gmerlin-avdecoder: FTBFS: 
demux_ffmpeg.c:535:45: error: ‘AVCodecParameters’ has no member named 
‘bits_per_sample’; did you mean ‘bits_per_raw_sample’?
Added tag(s) pending.

-- 
1017181: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1017181
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#1018751: marked as done (igv: FTBFS (calls internet during tests new round))

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 11:04:24 +
with message-id 
and subject line Bug#1018751: fixed in igv 2.14.0+dfsg-2
has caused the Debian Bug report #1018751,
regarding igv: FTBFS (calls internet during tests new round)
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1018751: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1018751
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---

Source: igv
Version: 2.14.0+dfsg-1

(please note this is a new test failing! Thanks for fixing the previous ones)
Hello, as spot by Ubuntu builders [1] with a more restricted internet access,
your package is trying to call some external websites during testing.

Please use autopkgtests if you really want such tests to run.

see e.g.
+public static final String FASTA_URL = 
"https://s3.amazonaws.com/igv.broadinstitute.org/genomes/seq/hg38/hg38.fa";;
+public static final String COMPRESSED_FASTA_URL = 
"https://s3.amazonaws.com/igv.broadinstitute.org/genomes/seq/hg38/hg38.fa.gz";;
+public static final String EXPECTED_REFERENCE_BASES = 
"AAACCCAGGGCAAAGAATCTGGCCCTA"; //bases at 22:27198875-271988902

[1] 
https://launchpadlibrarian.net/620882774/buildlog_ubuntu-kinetic-amd64.igv_2.14.0+dfsg-1_BUILDING.txt.gz



org.broad.igv.sam.cram.IGVReferenceSourceTest > 
testGetReferenceBasesByRegionCompressed FAILED
org.broad.igv.feature.genome.GenomeException: IGV cannot readed gzipped 
fasta files.
at 
org.broad.igv.feature.genome.load.GenomeLoader.getLoader(GenomeLoader.java:53)
at 
org.broad.igv.feature.genome.GenomeManager.loadGenome(GenomeManager.java:197)
at 
org.broad.igv.sam.cram.IGVReferenceSourceTest.assertReferenceReqionRequestsWork(IGVReferenceSourceTest.java:57)
at 
org.broad.igv.sam.cram.IGVReferenceSourceTest.testGetReferenceBasesByRegionCompressed(IGVReferenceSourceTest.java:75)

org.broad.igv.sam.cram.IGVReferenceSourceTest > testGetReferenceBasesByRegion 
SKIPPED

org.broad.igv.sam.SamIndexTest > testGetIndexedChromosomes SKIPPED

org.broad.igv.prefs.PreferencesManagerTest > getPreferences SKIPPED

org.broad.igv.feature.ProbeToGeneMapTest > testAgilent SKIPPED

org.broad.igv.feature.ProbeToGeneMapTest > testAffy SKIPPED

org.broad.igv.feature.ProbeToGeneMapTest > testIllumina SKIPPED

org.broad.igv.feature.genome.fasta.FastaBlockCompressedSequenceTest > 
compareSequences SKIPPED

org.broad.igv.feature.genome.fasta.FastaBlockCompressedSequenceTest > 
findBlockContaining SKIPPED

org.broad.igv.feature.genome.ChromosomeNameComparatorTest > testSort 
STANDARD_OUT


org.broad.igv.sam.BAMFileReaderTest > testClose SKIPPED

org.broad.igv.sam.BAMFileReaderTest > testQueryAgainstSam SKIPPED

org.broad.igv.track.TrackLoaderTestHeaded STANDARD_OUT
You are trying to start a GUI in a headless environment. Aborting test

org.broad.igv.ui.panel.ReferenceFrameTestHeaded STANDARD_OUT
You are trying to start a GUI in a headless environment. Aborting test

org.broad.igv.tools.motiffinder.MotifFinderDialogHeadedTest STANDARD_OUT
You are trying to start a GUI in a headless environment. Aborting test

org.broad.igv.util.blat.LegacyBlatClientTest > fixWebBlat SKIPPED

org.broad.igv.util.blat.LegacyBlatClientTest > parseUCSCResult SKIPPED

org.broad.igv.util.blat.LegacyBlatClientTest > parseCustomResult SKIPPED

org.broad.igv.util.FileUtilsTest > testFindRelativeHttpPath STANDARD_OUT
dir/test.txt

org.broad.igv.util.LittleEndianInputStreamTest > testRead SKIPPED

org.broad.igv.data.cufflinks.ExpDiffCodecTest > testsamplegene_expdiff 
STANDARD_ERROR
SEVERE [Aug 30,2022 07:25] [ExpDiffCodec] LogRatio -1.79769e+308 cannot be 
parsed as a float
SEVERE [Aug 30,2022 07:25] [ExpDiffCodec] LogRatio 1.79769e+308 cannot be 
parsed as a float
SEVERE [Aug 30,2022 07:25] [ExpDiffCodec] LogRatio -1.79769e+308 cannot be 
parsed as a float

org.broad.igv.batch.CommandExecutorTest STANDARD_OUT
You are trying to start a GUI in a headless environment. Aborting test

org.broad.igv.tdf.TDFReaderTest > testReader SKIPPED

org.broad.igv.AbstractHeadlessTest > initializationError SKIPPED

org.broad.igv.htsget.HtsgetReaderTest > testReadHeader SKIPPED

org.broad.igv.htsget.HtsgetReaderTest > testReadData SKIPPED
Gradle Test Executor 1 finished executing tests.

org.broad.igv.tools.parsers.TestBEDCodecs > testGffTags SKIPPED

org.broad.igv.tools.parsers.TestBEDCodecs > testLength1Feature SKIPPED

org.broad.igv.tools.motiffinder.MotifFinderPluginHeadedTest STANDARD_OUT
You are trying to start a GUI in a headless environment. Aborting test

org.broad.igv.tools.moti

Processed: #970917: vzquota: unusable without kernel support

[Debian Bug Tracking System]

Processing control commands:

> clone -1 -2
Bug #970917 [src:vzquota] vzquota: unusable without kernel support
Bug 970917 cloned as bug 1018824
> reassign -2 ftp.debian.org
Bug #1018824 [src:vzquota] vzquota: unusable without kernel support
Bug reassigned from package 'src:vzquota' to 'ftp.debian.org'.
No longer marked as found in versions vzquota/3.1-4.
Ignoring request to alter fixed versions of bug #1018824 to the same values 
previously set
> retitle -2 RM: vzquota -- RoQA; orphaned, missing kernel support
Bug #1018824 [ftp.debian.org] vzquota: unusable without kernel support
Changed Bug title to 'RM: vzquota -- RoQA; orphaned, missing kernel support' 
from 'vzquota: unusable without kernel support'.
> affects -2 src:vzquota
Bug #1018824 [ftp.debian.org] RM: vzquota -- RoQA; orphaned, missing kernel 
support
Added indication that 1018824 affects src:vzquota
> severity -2 normal
Bug #1018824 [ftp.debian.org] RM: vzquota -- RoQA; orphaned, missing kernel 
support
Severity set to 'normal' from 'serious'

-- 
1018824: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1018824
970917: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=970917
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#970917: #970917: vzquota: unusable without kernel support

[Chris Hofstaedtler]

Control: clone -1 -2
Control: reassign -2 ftp.debian.org
Control: retitle -2 RM: vzquota -- RoQA; orphaned, missing kernel support
Control: affects -2 src:vzquota
Control: severity -2 normal

Dear ftpmasters,

please remove vzquota. It is orphaned for a long time, and requires
kernel patches that have not been in Debian since stretch or older.

Thanks,
Chris

Processed: #970916: vzctl: unusable without kernel support

[Debian Bug Tracking System]

Processing control commands:

> clone -1 -2
Bug #970916 [src:vzctl] vzctl: unusable without kernel support
Bug 970916 cloned as bug 1018823
> reassign -2 ftp.debian.org
Bug #1018823 [src:vzctl] vzctl: unusable without kernel support
Bug reassigned from package 'src:vzctl' to 'ftp.debian.org'.
No longer marked as found in versions vzctl/4.9.4-6.
Ignoring request to alter fixed versions of bug #1018823 to the same values 
previously set
> retitle -2 RM: vzctl -- RoQA; orphaned, missing kernel support
Bug #1018823 [ftp.debian.org] vzctl: unusable without kernel support
Changed Bug title to 'RM: vzctl -- RoQA; orphaned, missing kernel support' from 
'vzctl: unusable without kernel support'.
> affects -2 src:vzctl
Bug #1018823 [ftp.debian.org] RM: vzctl -- RoQA; orphaned, missing kernel 
support
Added indication that 1018823 affects src:vzctl
> severity -2 normal
Bug #1018823 [ftp.debian.org] RM: vzctl -- RoQA; orphaned, missing kernel 
support
Severity set to 'normal' from 'serious'

-- 
1018823: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1018823
970916: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=970916
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#970916: #970916: vzctl: unusable without kernel support

[Chris Hofstaedtler]

Control: clone -1 -2
Control: reassign -2 ftp.debian.org
Control: retitle -2 RM: vzctl -- RoQA; orphaned, missing kernel support
Control: affects -2 src:vzctl
Control: severity -2 normal

Dear ftpmasters,

please remove vzctl. It is orphaned for a long time, and requires
kernel patches that have not been in Debian since stretch or older.

Thanks,
Chris

Processed: severity of 1009915 is serious, tagging 1016625, affects 1016625, tagging 702948, closing 1016625

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> severity 1009915 serious
Bug #1009915 [src:sysvinit] sysvinit: Please align with manpages-l10n and 
afterwards activate man page translations
Severity set to 'serious' from 'wishlist'
> tags 1016625 - ftbfs
Bug #1016625 [nvidia-cuda-toolkit] Please update nvidia-cuda-toolkit to 11.5.1 
or later
Removed tag(s) ftbfs.
> affects 1016625 + src:bart-cuda
Bug #1016625 [nvidia-cuda-toolkit] Please update nvidia-cuda-toolkit to 11.5.1 
or later
Added indication that 1016625 affects src:bart-cuda
> tags 702948 - wontfix
Bug #702948 [nvidia-cuda-toolkit] nvidia-cuda-toolkit: please provide sdk 
samples
Removed tag(s) wontfix.
> close 1016625 11.5.1-1
Bug #1016625 [nvidia-cuda-toolkit] Please update nvidia-cuda-toolkit to 11.5.1 
or later
Marked as fixed in versions nvidia-cuda-toolkit/11.5.1-1.
Bug #1016625 [nvidia-cuda-toolkit] Please update nvidia-cuda-toolkit to 11.5.1 
or later
Marked Bug as done
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
1009915: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1009915
1016625: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1016625
702948: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=702948
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#1018821: gdb: FTBFS with readline 8.2 due to constness changes

[Andreas Beckmann]

Source: gdb
Version: 12.1-3
Severity: serious
Tags: ftbfs
Justification: fails to build from source (but built successfully in the past)

Hi,

gdb FTBFS in sid since readline 8.2 was uploaded there:

/build/gdb-12.1/gdb/completer.c: In function 'char* 
gdb_completion_word_break_characters_throw()':
/build/gdb-12.1/gdb/completer.c:2014:10: error: invalid conversion from 'const 
char*' to 'char*' [-fpermissive]
 2014 |   return rl_completer_word_break_characters;
  |  ^~
  |  |
  |  const char*


Andreas

Bug#1017167: marked as done (theseus: FTBFS: DLTutils.c:427:11: error: pointer ‘outfile’ used after ‘fclose’ [-Werror=use-after-free])

[Debian Bug Tracking System]

Your message dated Wed, 31 Aug 2022 13:10:47 +0530
with message-id <20220831074047.uzep67p62pkix...@nileshpatra.info>
and subject line Re: theseus: FTBFS: DLTutils.c:427:11: error: pointer 
‘outfile’ used after ‘fclose’ [-Werror=use-after-free]
has caused the Debian Bug report #1017167,
regarding theseus: FTBFS: DLTutils.c:427:11: error: pointer ‘outfile’ used 
after ‘fclose’ [-Werror=use-after-free]
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
1017167: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1017167
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: theseus
Version: 3.3.0-11
Severity: serious
Justification: FTBFS
Tags: bookworm sid ftbfs
User: lu...@debian.org
Usertags: ftbfs-20220813 ftbfs-bookworm

Hi,

During a rebuild of all packages in sid, your package failed to build
on amd64.


Relevant part (hopefully):
> /usr/bin/gcc -O3 -ffast-math -fstrict-aliasing -funroll-loops 
> -fomit-frame-pointer -Wall -Werror -pedantic -std=c99 -Wno-unused-result 
> -Wformat-truncation=0 -pthread  -c DLTutils.c
> DLTutils.c: In function ‘linefix’:
> DLTutils.c:427:11: error: pointer ‘outfile’ used after ‘fclose’ 
> [-Werror=use-after-free]
>   427 | return(outfile);
>   |   ^
> DLTutils.c:425:5: note: call to ‘fclose’ here
>   425 | fclose(outfile);
>   | ^~~
> cc1: all warnings being treated as errors
> make[3]: *** [Makefile:10: DLTutils.o] Error 1


The full build log is available from:
http://qa-logs.debian.net/2022/08/13/theseus_3.3.0-11_unstable.log

All bugs filed during this archive rebuild are listed at:
https://bugs.debian.org/cgi-bin/pkgreport.cgi?tag=ftbfs-20220813;users=lu...@debian.org
or:
https://udd.debian.org/bugs/?release=na&merged=ign&fnewerval=7&flastmodval=7&fusertag=only&fusertagtag=ftbfs-20220813&fusertaguser=lu...@debian.org&allbugs=1&cseverity=1&ctags=1&caffected=1#results

A list of current common problems and possible solutions is available at
http://wiki.debian.org/qa.debian.org/FTBFS . You're welcome to contribute!

If you reassign this bug to another package, please marking it as 'affects'-ing
this package. See https://www.debian.org/Bugs/server-control#affects

If you fail to reproduce this, please provide a build log and diff it with mine
so that we can identify if something relevant changed in the meantime.


--- End Message ---
--- Begin Message ---
Version: 3.3.0-12

This is a duplicate of #1017325
 

-- 
Best,
Nilesh


signature.asc
Description: PGP signature
--- End Message ---

Processed: pkgconf-bin: removal of pkgconf-bin makes files disappear from pkgconf

[Debian Bug Tracking System]

Processing control commands:

> affects -1 + pkgconf
Bug #1018813 [pkgconf-bin] pkgconf-bin: removal of pkgconf-bin makes files 
disappear from pkgconf
Added indication that 1018813 affects pkgconf

-- 
1018813: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1018813
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#1018813: pkgconf-bin: removal of pkgconf-bin makes files disappear from pkgconf

[Andreas Beckmann]

Package: pkgconf-bin
Version: 1.8.0-2
Severity: serious
User: debian...@lists.debian.org
Usertags: piuparts replaces-without-breaks
Control: affects -1 + pkgconf

Hi,

during a test with piuparts and DOSE tools I noticed your package causes
removal of files that also belong to another package.
This is caused by using Replaces without corresponding Breaks.

The installation sequence to reproduce this problem is

  apt-get install pkgconf/testing
  # (1)
  apt-get install pkgconf-bin/sid
  apt-get remove pkgconf-bin
  # (2)

The list of installed files at points (1) and (2) should be identical,
but the following files have disappeared:

  /usr/bin/pkgconf

This is a serious bug violating policy 7.6, see
https://www.debian.org/doc/debian-policy/ch-relationships.html#overwriting-files-and-replacing-packages-replaces
and also see the footnote that describes this incorrect behavior:
https://www.debian.org/doc/debian-policy/ch-relationships.html#id13

The pkgconf-bin package has the following relationships with pkgconf:

  Conflicts: n/a
  Breaks:n/a
  Replaces:  pkgconf (<< 1.8.0-2~)

>From the attached log (scroll to the bottom...):

0m31.4s ERROR: FAIL: After purging files have disappeared:
  /usr/bin/pkgconf   owned by: pkgconf-bin

0m31.4s ERROR: FAIL: After purging files have been modified:
  /var/lib/dpkg/info/pkgconf.listnot owned


cheers,

Andreas


pkgconf=1.8.0-1_pkgconf-bin=1.8.0-3.log.gz
Description: application/gzip