[med-svn] [Git][med-team/libmmap-allocator][master] Minor fix to hardening patch
Nilesh Patra pushed to branch master at Debian Med / libmmap-allocator Commits: af74417f by Nilesh Patra at 2024-05-26T16:09:47+05:30 Minor fix to hardening patch - - - - - 1 changed file: - debian/patches/hardening.patch Changes: = debian/patches/hardening.patch = @@ -20,3 +20,12 @@ libmmap_allocator.a: mmap_file_pool.o $(AR) r libmmap_allocator.a mmap_file_pool.o +@@ -44,7 +44,7 @@ + bash -c 'export LD_LIBRARY_PATH=. ; ./test_allocator' + + test_allocator: mmap_allocator.h mmap_file_pool.o test_allocator.o $(LIBRARIES) +- $(CXX) test_allocator.o -L. -lmmap_allocator -o test_allocator ++ $(CXX) test_allocator.o -L. -lmmap_allocator -o test_allocator $(LDFLAGS) + + test_mmap_fixed: test_mmap_fixed.c + $(CC) $(CFLAGS) test_mmap_fixed.c -o test_mmap_fixed View it on GitLab: https://salsa.debian.org/med-team/libmmap-allocator/-/commit/af74417f1154bc6de9ad30066205748d58cd830b -- This project does not include diff previews in email notifications. View it on GitLab: https://salsa.debian.org/med-team/libmmap-allocator/-/commit/af74417f1154bc6de9ad30066205748d58cd830b You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/libmmap-allocator] Pushed new tag debian/0.4.0+git20200122.adbfbe1-2
Nilesh Patra pushed new tag debian/0.4.0+git20200122.adbfbe1-2 at Debian Med / libmmap-allocator -- This project does not include diff previews in email notifications. View it on GitLab: https://salsa.debian.org/med-team/libmmap-allocator/-/tree/debian/0.4.0+git20200122.adbfbe1-2 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/libmmap-allocator][master] 5 commits: Add patch to get package cross-building
Nilesh Patra pushed to branch master at Debian Med / libmmap-allocator Commits: df9fcfaa by Nilesh Patra at 2024-05-26T15:26:12+05:30 Add patch to get package cross-building - - - - - f5a37322 by Nilesh Patra at 2024-05-26T15:27:13+05:30 d/rules: Use dh_auto_build instead of hardcoding MAKE - - - - - 4b774a89 by Nilesh Patra at 2024-05-26T15:27:19+05:30 Revert "Install shared lib as well" This reverts commit f5227650a16a6340a8bccf2b3a9ea169e375cbff. - - - - - f3ce162f by Nilesh Patra at 2024-05-26T15:31:20+05:30 Add patch for hardening opts - - - - - bd89e519 by Nilesh Patra at 2024-05-26T15:35:05+05:30 Upload to unstable - - - - - 6 changed files: - debian/changelog - debian/install - + debian/patches/cross.patch - + debian/patches/hardening.patch - debian/patches/series - debian/rules Changes: = debian/changelog = @@ -1,3 +1,14 @@ +libmmap-allocator (0.4.0+git20200122.adbfbe1-2) unstable; urgency=medium + + * Team Upload. + * Install shared lib as well + * Bump Standards-Version to 4.7.0 (no changes needed) + * Add patch to get package cross-building + * d/rules: Use dh_auto_build instead of hardcoding MAKE + * Add patch for hardening opts + + -- Nilesh Patra Sun, 26 May 2024 15:34:47 +0530 + libmmap-allocator (0.4.0+git20200122.adbfbe1-1) unstable; urgency=medium * For iitii package the latest commit is needed = debian/install = @@ -1,4 +1,4 @@ #!/usr/bin/dh-exec *.husr/include -libmmap_allocator.so usr/lib/${DEB_HOST_MULTIARCH} +#libmmap_allocator.so usr/lib/${DEB_HOST_MULTIARCH} libmmap_allocator.ausr/lib/${DEB_HOST_MULTIARCH} = debian/patches/cross.patch = @@ -0,0 +1,35 @@ +--- a/Makefile b/Makefile +@@ -1,3 +1,6 @@ ++CC ?= gcc ++CXX ?= g++ ++AR ?= ar + CPPFLAGS=-g -Wall -fPIC + CFLAGS=-g -Wall -fPIC + +@@ -20,10 +23,10 @@ + debug: clean all + + libmmap_allocator.so: mmap_file_pool.o +- g++ -shared -o libmmap_allocator.so mmap_file_pool.o ++ $(CXX) -shared -o libmmap_allocator.so mmap_file_pool.o + + libmmap_allocator.a: mmap_file_pool.o +- ar r libmmap_allocator.a mmap_file_pool.o ++ $(AR) r libmmap_allocator.a mmap_file_pool.o + + install_sources: $(SOURCES) + cp $(SOURCES) $(SRC_INSTALL_TARGET_DIR) +@@ -41,10 +44,10 @@ + bash -c 'export LD_LIBRARY_PATH=. ; ./test_allocator' + + test_allocator: mmap_allocator.h mmap_file_pool.o test_allocator.o $(LIBRARIES) +- g++ test_allocator.o -L. -lmmap_allocator -o test_allocator ++ $(CXX) test_allocator.o -L. -lmmap_allocator -o test_allocator + + test_mmap_fixed: test_mmap_fixed.c +- gcc $(CFLAGS) test_mmap_fixed.c -o test_mmap_fixed ++ $(CC) $(CFLAGS) test_mmap_fixed.c -o test_mmap_fixed + + clean: + rm -f test_allocator test_mmap_fixed testfile testfile2 *.o $(LIBRARIES) = debian/patches/hardening.patch = @@ -0,0 +1,22 @@ +--- a/Makefile b/Makefile +@@ -1,8 +1,8 @@ + CC ?= gcc + CXX ?= g++ + AR ?= ar +-CPPFLAGS=-g -Wall -fPIC +-CFLAGS=-g -Wall -fPIC ++CPPFLAGS += -g -Wall -fPIC ++CFLAGS += -g -Wall -fPIC + + # Enable to test with GCC 3.4 + # CXX=g++34 +@@ -23,7 +23,7 @@ + debug: clean all + + libmmap_allocator.so: mmap_file_pool.o +- $(CXX) -shared -o libmmap_allocator.so mmap_file_pool.o ++ $(CXX) -shared -o libmmap_allocator.so mmap_file_pool.o $(LDFLAGS) + + libmmap_allocator.a: mmap_file_pool.o + $(AR) r libmmap_allocator.a mmap_file_pool.o = debian/patches/series = @@ -1 +1,3 @@ # soname.patch +cross.patch +hardening.patch = debian/rules = @@ -6,7 +6,7 @@ dh $@ override_dh_auto_build: - $(MAKE) libmmap_allocator.so libmmap_allocator.a + dh_auto_build -- libmmap_allocator.so libmmap_allocator.a override_dh_auto_test: ifeq (,$(filter nocheck,$(DEB_BUILD_OPTIONS))) View it on GitLab: https://salsa.debian.org/med-team/libmmap-allocator/-/compare/e083ff5f29832c2c513c6e36b40e01eb707c2a03...bd89e5196543e74f79e21108591b063e15a9d051 -- This project does not include diff previews in email notifications. View it on GitLab: https://salsa.debian.org/med-team/libmmap-allocator/-/compare/e083ff5f29832c2c513c6e36b40e01eb707c2a03...bd89e5196543e74f79e21108591b063e15a9d051 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/libmmap-allocator][master] Bump Standards-Version to 4.7.0 (no changes needed)
Nilesh Patra pushed to branch master at Debian Med / libmmap-allocator Commits: e083ff5f by Nilesh Patra at 2024-05-26T14:58:22+05:30 Bump Standards-Version to 4.7.0 (no changes needed) - - - - - 1 changed file: - debian/control Changes: = debian/control = @@ -5,7 +5,7 @@ Section: libdevel Priority: optional Build-Depends: debhelper-compat (= 13), dh-exec -Standards-Version: 4.5.0 +Standards-Version: 4.7.0 Vcs-Browser: https://salsa.debian.org/med-team/libmmap-allocator Vcs-Git: https://salsa.debian.org/med-team/libmmap-allocator.git Homepage: https://github.com/ekg/mmap_allocator/ View it on GitLab: https://salsa.debian.org/med-team/libmmap-allocator/-/commit/e083ff5f29832c2c513c6e36b40e01eb707c2a03 -- This project does not include diff previews in email notifications. View it on GitLab: https://salsa.debian.org/med-team/libmmap-allocator/-/commit/e083ff5f29832c2c513c6e36b40e01eb707c2a03 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/blimps][master] 2 commits: Add patch to fix FTBFS with implicit-function-declaration (Closes: #1066956)
Nilesh Patra pushed to branch master at Debian Med / blimps Commits: e0ea8796 by Nilesh Patra at 2024-04-14T03:06:56+05:30 Add patch to fix FTBFS with implicit-function-declaration (Closes: #1066956) - - - - - b304527b by Nilesh Patra at 2024-04-14T03:07:25+05:30 Upload to unstable - - - - - 3 changed files: - debian/changelog - + debian/patches/fixup-implicit-function-declaration.patch - debian/patches/series Changes: = debian/changelog = @@ -1,3 +1,11 @@ +blimps (3.9+ds-2) unstable; urgency=medium + + * Team Upload. + * Add patch to fix FTBFS with +implicit-function-declaration (Closes: #1066956) + + -- Nilesh Patra Sun, 14 Apr 2024 03:07:00 +0530 + blimps (3.9+ds-1) unstable; urgency=medium * Homepage vanished - point to waybackmachine as homepage = debian/patches/fixup-implicit-function-declaration.patch = @@ -0,0 +1,17 @@ +--- a/blimps/biassed_blocks_finder.c b/blimps/biassed_blocks_finder.c +@@ -17,14 +17,8 @@ + char *val; + } entry; + +-/* from util.c */ +-/* +-char *makeword(char *line, char stop); +-char *fmakeword(FILE *f, char stop, int *len); +-char x2c(char *what); + void unescape_url(char *url); + void plustospace(char *str); +-*/ + // lkajan: very nice but util.c does not have an interface defined + // lkajan: can't figure out where this came from but it certainly picked up the wrong fmakeword + char *fmakeword(FILE *f, char stop, int *cl); = debian/patches/series = @@ -2,3 +2,4 @@ gets.patch makefile.patch hardening.patch avoid_privacy_breach.patch +fixup-implicit-function-declaration.patch View it on GitLab: https://salsa.debian.org/med-team/blimps/-/compare/dc07906fb3376114f1a2826058cddf72a7d59895...b304527b77ed2ef7537c6d36559e925f9f290d56 -- View it on GitLab: https://salsa.debian.org/med-team/blimps/-/compare/dc07906fb3376114f1a2826058cddf72a7d59895...b304527b77ed2ef7537c6d36559e925f9f290d56 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/blimps] Pushed new tag debian/3.9+ds-2
Nilesh Patra pushed new tag debian/3.9+ds-2 at Debian Med / blimps -- View it on GitLab: https://salsa.debian.org/med-team/blimps/-/tree/debian/3.9+ds-2 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/maude][master] 5 commits: Drop patch file
Nilesh Patra pushed to branch master at Debian Med / maude Commits: e11f6096 by Nilesh Patra at 2024-04-07T16:22:20+05:30 Drop patch file - - - - - 875abbea by Nilesh Patra at 2024-04-07T16:24:16+05:30 Update Builddep from libncurses5-dev => libncurses-dev (former is a virtual package) - - - - - d66e3a93 by Nilesh Patra at 2024-04-07T16:24:30+05:30 Bump Standards-Version to 4.6.2 (no changes needed) - - - - - e25c5880 by Nilesh Patra at 2024-04-07T16:27:50+05:30 Remove copyright for superfluous file - - - - - c1f2b3cc by Nilesh Patra at 2024-04-07T16:28:49+05:30 Upload to unstable - - - - - 4 changed files: - debian/changelog - debian/control - debian/copyright - − debian/patches/glibc-2.34.patch Changes: = debian/changelog = @@ -1,10 +1,15 @@ -maude (3.4-1) UNRELEASED; urgency=medium +maude (3.4-1) unstable; urgency=medium * Team Upload. - * New upstream version 3.4 + * New upstream version 3.4 (Closes: #1067957) * Refresh, update patches + * Drop patch file + * Update Builddep from libncurses5-dev => libncurses-dev +(former is a virtual package) + * Bump Standards-Version to 4.6.2 (no changes needed) + * Remove copyright for superfluous file - -- Nilesh Patra Sun, 07 Apr 2024 15:39:24 +0530 + -- Nilesh Patra Sun, 07 Apr 2024 16:28:11 +0530 maude (3.2-2) unstable; urgency=medium = debian/control = @@ -11,9 +11,9 @@ Build-Depends: debhelper-compat (= 13), libsigsegv-dev, bison, flex, - libncurses5-dev, + libncurses-dev, libcvc4-dev -Standards-Version: 4.6.0 +Standards-Version: 4.6.2 Vcs-Browser: https://salsa.debian.org/med-team/maude Vcs-Git: https://salsa.debian.org/med-team/maude.git Homepage: http://maude.cs.uiuc.edu = debian/copyright = @@ -7,38 +7,6 @@ Files: * Copyright: 1997-2011 SRI International, Menlo Park, CA 94025, USA. License: GPL-2+ -Files: src/3rdParty/MersenneTwister.h -Copyright: 2000 - 2003, Richard J. Wagner -License: BSD-like - Redistribution and use in source and binary forms, with or without - modification, are permitted provided that the following conditions - are met: - . - 1. Redistributions of source code must retain the above copyright - notice, this list of conditions and the following disclaimer. - . - 2. Redistributions in binary form must reproduce the above copyright - notice, this list of conditions and the following disclaimer in the - documentation and/or other materials provided with the distribution. - . - 3. The names of its contributors may not be used to endorse or promote - products derived from this software without specific prior written - permission. - . - THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS - "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT - LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR - A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR - CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, - EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, - PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR - PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF - LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING - NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS - SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. -Comment: For citation information see - file debian/upstream-metadata.yaml - Files: debian/* Copyright: 2011 Scott Christley , Andreas Tille = debian/patches/glibc-2.34.patch deleted = View it on GitLab: https://salsa.debian.org/med-team/maude/-/compare/781944d7e2e50109bc4c9b59a1b364f2b8a5c432...c1f2b3cc86c168f7f853a611f01619ba9a73d1c1 -- View it on GitLab: https://salsa.debian.org/med-team/maude/-/compare/781944d7e2e50109bc4c9b59a1b364f2b8a5c432...c1f2b3cc86c168f7f853a611f01619ba9a73d1c1 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/maude] Pushed new tag debian/3.4-1
Nilesh Patra pushed new tag debian/3.4-1 at Debian Med / maude -- View it on GitLab: https://salsa.debian.org/med-team/maude/-/tree/debian/3.4-1 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/maude][pristine-tar] pristine-tar data for maude_3.4.orig.tar.gz
Nilesh Patra pushed to branch pristine-tar at Debian Med / maude Commits: 3ed467bc by Nilesh Patra at 2024-04-07T16:29:47+05:30 pristine-tar data for maude_3.4.orig.tar.gz - - - - - 2 changed files: - + maude_3.4.orig.tar.gz.delta - + maude_3.4.orig.tar.gz.id Changes: = maude_3.4.orig.tar.gz.delta = Binary files /dev/null and b/maude_3.4.orig.tar.gz.delta differ = maude_3.4.orig.tar.gz.id = @@ -0,0 +1 @@ +e1a88830708fe1fcc46a0495f1f7f52c30dd91aa View it on GitLab: https://salsa.debian.org/med-team/maude/-/commit/3ed467bcd25eb8e2d7db757c6224dfe398b108c4 -- View it on GitLab: https://salsa.debian.org/med-team/maude/-/commit/3ed467bcd25eb8e2d7db757c6224dfe398b108c4 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/maude][master] 4 commits: New upstream version 3.4
Nilesh Patra pushed to branch master at Debian Med / maude Commits: 5afd3e99 by Nilesh Patra at 2024-04-07T15:20:32+05:30 New upstream version 3.4 - - - - - 0420a331 by Nilesh Patra at 2024-04-07T15:20:32+05:30 Update upstream source from tag 'upstream/3.4' Update to upstream version '3.4' with Debian dir f5b81c0ca7d5e6216a57e9aba956fa3243b82864 - - - - - 02a2864e by Nilesh Patra at 2024-04-07T15:39:21+05:30 Refresh, update patches - - - - - 781944d7 by Nilesh Patra at 2024-04-07T15:39:43+05:30 Interim d/ch - - - - - 10 changed files: - + .gitignore - ChangeLog - INSTALL - Makefile.am - Makefile.in - NEWS - − README - + README.md - compile - config.guess The diff was not included because it is too large. View it on GitLab: https://salsa.debian.org/med-team/maude/-/compare/339f0e5964fd7405efe217def50c4ddba48e67bd...781944d7e2e50109bc4c9b59a1b364f2b8a5c432 -- View it on GitLab: https://salsa.debian.org/med-team/maude/-/compare/339f0e5964fd7405efe217def50c4ddba48e67bd...781944d7e2e50109bc4c9b59a1b364f2b8a5c432 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/maude][upstream] New upstream version 3.4
Nilesh Patra pushed to branch upstream at Debian Med / maude Commits: 5afd3e99 by Nilesh Patra at 2024-04-07T15:20:32+05:30 New upstream version 3.4 - - - - - 10 changed files: - + .gitignore - ChangeLog - INSTALL - Makefile.am - Makefile.in - NEWS - − README - + README.md - compile - config.guess The diff was not included because it is too large. View it on GitLab: https://salsa.debian.org/med-team/maude/-/commit/5afd3e9923ca00d7aab807c93dd138f603b9fa77 -- View it on GitLab: https://salsa.debian.org/med-team/maude/-/commit/5afd3e9923ca00d7aab807c93dd138f603b9fa77 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/maude] Pushed new tag upstream/3.4
Nilesh Patra pushed new tag upstream/3.4 at Debian Med / maude -- View it on GitLab: https://salsa.debian.org/med-team/maude/-/tree/upstream/3.4 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/fastdnaml][master] 3 commits: Add patch to fix FTBFS with implicit-function-declaration (Closes: #1066709)
Nilesh Patra pushed to branch master at Debian Med / fastdnaml Commits: 596df407 by Nilesh Patra at 2024-04-07T14:47:19+05:30 Add patch to fix FTBFS with implicit-function-declaration (Closes: #1066709) - - - - - 00d0112e by Nilesh Patra at 2024-04-07T14:47:38+05:30 Bump Standards-Version to 4.6.2 (no changes needed) - - - - - 1ba1470a by Nilesh Patra at 2024-04-07T14:48:08+05:30 Upload to unstable - - - - - 4 changed files: - debian/changelog - debian/control - + debian/patches/fixup-implicit-function-declaration.patch - debian/patches/series Changes: = debian/changelog = @@ -1,3 +1,12 @@ +fastdnaml (1.2.2-16) unstable; urgency=medium + + * Team Upload. + * Add patch to fix FTBFS with +implicit-function-declaration (Closes: #1066709) + * Bump Standards-Version to 4.6.2 (no changes needed) + + -- Nilesh Patra Sun, 07 Apr 2024 14:47:48 +0530 + fastdnaml (1.2.2-15) unstable; urgency=medium * Standards-Version: 4.5.1 (routine-update) = debian/control = @@ -5,7 +5,7 @@ Uploaders: Andreas Tille , Section: science Priority: optional Build-Depends: debhelper-compat (= 13) -Standards-Version: 4.5.1 +Standards-Version: 4.6.2 Vcs-Browser: https://salsa.debian.org/med-team/fastdnaml Vcs-Git: https://salsa.debian.org/med-team/fastdnaml.git Homepage: ftp://ftp.bio.indiana.edu/molbio/evolve/fastdnaml/fastDNAml.html = debian/patches/fixup-implicit-function-declaration.patch = @@ -0,0 +1,63 @@ +--- a/source/fastDNAml.h b/source/fastDNAml.h +@@ -5,6 +5,7 @@ + #define headerDate "March 9, 1998" + + #ifndef dnaml_h ++#include + + /* Compile time switches for various updates to program: + *0 gives original version +@@ -218,7 +219,7 @@ + + #if ANSI || MALLOC_VOID +void *malloc(); +-#else ++#elif !defined(__STDC__) +char *malloc(); + #endif + +--- a/source/fastDNAml.c b/source/fastDNAml.c +@@ -204,6 +204,8 @@ + + #include + #include ++#include ++#include + #include "fastDNAml.h" /* Requires version 1.2 */ + + #if Master || Slave +@@ -2853,32 +2855,6 @@ + } /* buildSimpleTree */ + + +-char * strchr (char *str, int chr) +- { /* strchr */ +-int c; +- +-while (c = *str) {if (c == chr) return str; str++;} +-return (char *) NULL; +- } /* strchr */ +- +- +-char * strstr (char *str1, char *str2) +- { /* strstr */ +-char *s1, *s2; +-int c; +- +-while (*(s1 = str1)) { +- s2 = str2; +- do { +-if (! (c = *s2++)) return str1; +-} +-while (*s1++ == c); +- str1++; +- } +-return (char *) NULL; +- } /* strstr */ +- +- + boolean readKeyValue (char *string, char *key, char *format, void *value) + { /* readKeyValue */ + = debian/patches/series = @@ -2,3 +2,4 @@ Makefile.patch scripts.patch hardening.patch cross.patch +fixup-implicit-function-declaration.patch View it on GitLab: https://salsa.debian.org/med-team/fastdnaml/-/compare/45a7df96e9c18365a9aff09e55387a417ddf006f...1ba1470ac35cbc7b216893c907ac0aa43421e1d3 -- View it on GitLab: https://salsa.debian.org/med-team/fastdnaml/-/compare/45a7df96e9c18365a9aff09e55387a417ddf006f...1ba1470ac35cbc7b216893c907ac0aa43421e1d3 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/fastdnaml] Pushed new tag debian/1.2.2-16
Nilesh Patra pushed new tag debian/1.2.2-16 at Debian Med / fastdnaml -- View it on GitLab: https://salsa.debian.org/med-team/fastdnaml/-/tree/debian/1.2.2-16 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/phast][master] Upload to unstable
Nilesh Patra pushed to branch master at Debian Med / phast Commits: 1ecf52be by Nilesh Patra at 2024-03-26T15:21:23+05:30 Upload to unstable - - - - - 1 changed file: - debian/changelog Changes: = debian/changelog = @@ -1,3 +1,12 @@ +phast (1.6+dfsg-5) unstable; urgency=medium + + * Team Upload. + * Add patch to fix FTBFS due to -Werror-implicit-function-declaration +(Closes: #1066451) + * Added B-D on lapacke-dev for porting functions to lapack equivalents + + -- Nilesh Patra Tue, 26 Mar 2024 15:19:11 +0530 + phast (1.6+dfsg-4) unstable; urgency=medium [ Andreas Tille ] View it on GitLab: https://salsa.debian.org/med-team/phast/-/commit/1ecf52beedc6cab1372af683162a57c38c84d813 -- View it on GitLab: https://salsa.debian.org/med-team/phast/-/commit/1ecf52beedc6cab1372af683162a57c38c84d813 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/phast] Pushed new tag debian/1.6+dfsg-5
Nilesh Patra pushed new tag debian/1.6+dfsg-5 at Debian Med / phast -- View it on GitLab: https://salsa.debian.org/med-team/phast/-/tree/debian/1.6+dfsg-5 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/hmmer2][master] Upload to unstable
Nilesh Patra pushed to branch master at Debian Med / hmmer2 Commits: 74ad5321 by Nilesh Patra at 2024-03-25T18:17:26+05:30 Upload to unstable - - - - - 1 changed file: - debian/changelog Changes: = debian/changelog = @@ -1,3 +1,11 @@ +hmmer2 (2.3.2+dfsg-11) unstable; urgency=medium + + * Team Upload. + * Fixup regression in autopkgtests introduced w/ previous +upload. + + -- Nilesh Patra Mon, 25 Mar 2024 18:17:17 +0530 + hmmer2 (2.3.2+dfsg-10) unstable; urgency=medium * Team Upload. View it on GitLab: https://salsa.debian.org/med-team/hmmer2/-/commit/74ad532194c54726b0b8172471d551fc5c8a5f03 -- View it on GitLab: https://salsa.debian.org/med-team/hmmer2/-/commit/74ad532194c54726b0b8172471d551fc5c8a5f03 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/hmmer2] Pushed new tag debian/2.3.2+dfsg-11
Nilesh Patra pushed new tag debian/2.3.2+dfsg-11 at Debian Med / hmmer2 -- View it on GitLab: https://salsa.debian.org/med-team/hmmer2/-/tree/debian/2.3.2+dfsg-11 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/hmmer2][master] Fixup autopkgtests
Nilesh Patra pushed to branch master at Debian Med / hmmer2 Commits: 4429e204 by Nilesh Patra at 2024-03-25T18:07:42+05:30 Fixup autopkgtests - - - - - 2 changed files: - + debian/tests/Makefile.test - debian/tests/run-unit-test Changes: = debian/tests/Makefile.test = @@ -0,0 +1,79 @@ + +# Makefile for HMMER testsuite +# CVS $Id: Makefile.in,v 1.18 2003/06/13 20:05:31 eddy Exp $ +## +# HMMER - Biological sequence analysis with profile HMMs +# Copyright (C) 1992-2003 Washington University School of Medicine +# All Rights Reserved +# +# This source code is distributed under the terms of the +# GNU General Public License. See the files COPYING and LICENSE +# for details. +### + +CC= gcc +CFLAGS= -g -O2 -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection +CPPFLAGS = -Wdate-time -D_FORTIFY_SOURCE=2 +LDFLAGS = -Wl,-z,relro -Wl,-z,now +DEFS = -DHAVE_CONFIG_H +LIBS = -lm +MYLIBS= -lhmmer `pkg-config --libs libsquid` + +# Configuration for optional pthreads multiprocessor support +# +PTHREAD_LIBS = +PTHREAD_CFLAGS = + +SHELL = /bin/sh + +SHIVA = alignalign_test\ + evd_test\ + masks_test\ + parsingviterbi_test\ + tophits_test\ + trace_test\ + viterbi_exercise\ + weeviterbi_test + +### +## Targets defining how to make Shiva executables. +### + +.c.o: + $(CC) $(CFLAGS) $(PTHREAD_CFLAGS) ${CPPFLAGS} $(DEFS) `pkg-config --cflags libsquid` -I../src -I/usr/include/hmmer2 -c $< + +all: $(SHIVA) + +$(SHIVA): %: %.o + $(CC) $(CFLAGS) $(PTHREAD_CFLAGS) ${LDFLAGS} $(DEFS) -o $@ -L../src $@.o $(MYLIBS) $(PTHREAD_LIBS) $(LIBS) + +### +## `make check` actually runs the tests. +### + +check: + @echo + @echo Running test suite exercises. + @echo Warning: some tests may take several minutes to complete. + @echo + ./sqc 2 exercises.sqc . ../src + + +### +## Miscellaneous +### + +clean: + -rm -f *.o *~ Makefile.bak core $(SHIVA) TAGS gmon.out + +distclean: + make clean + -rm -f Makefile + +binclean: + -rm -f *.o *~ Makefile.bak core TAGS gmon.out + +TAGS: + etags -t *.c *.h Makefile.in + + = debian/tests/run-unit-test = @@ -8,12 +8,12 @@ if [ "$AUTOPKGTEST_TMP" = "" ] ; then fi cp -a /usr/share/doc/${pkg}/examples/* $AUTOPKGTEST_TMP +cp debian/tests/Makefile.test $AUTOPKGTEST_TMP cd $AUTOPKGTEST_TMP find . -name "*.gz" -exec gunzip \{\} \; -sed -i 's|$(CC) $(CFLAGS) $(PTHREAD_CFLAGS) ${CPPFLAGS} $(DEFS) `pkg-config --cflags libsquid` -I../src -c $<|$(CC) $(CFLAGS) $(PTHREAD_CFLAGS) ${CPPFLAGS} $(DEFS) `pkg-config --cflags libsquid` -I../src -I/usr/include/hmmer2 -c $<|' Makefile -make +make -f Makefile.test testnames=`cut -f2 -d '@' ./exercises.sqc | grep "_test\|_exercise"` chmod +x $testnames View it on GitLab: https://salsa.debian.org/med-team/hmmer2/-/commit/4429e2043d2b33652d6ad3430e84cac8d2d5e938 -- View it on GitLab: https://salsa.debian.org/med-team/hmmer2/-/commit/4429e2043d2b33652d6ad3430e84cac8d2d5e938 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/hmmer2] Pushed new tag debian/2.3.2+dfsg-10
Nilesh Patra pushed new tag debian/2.3.2+dfsg-10 at Debian Med / hmmer2 -- View it on GitLab: https://salsa.debian.org/med-team/hmmer2/-/tree/debian/2.3.2+dfsg-10 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/hmmer2][master] 6 commits: Add patch to fix FTBFS
Nilesh Patra pushed to branch master at Debian Med / hmmer2 Commits: ca3a07cd by Nilesh Patra at 2024-03-25T13:08:20+05:30 Add patch to fix FTBFS - - - - - f6d21537 by Nilesh Patra at 2024-03-25T10:07:54+00:00 Pass GNU Test macro to resolve implicit function warning with pthread - - - - - 5d9277d3 by Nilesh Patra at 2024-03-25T10:20:03+00:00 Also run dh_clean in addition to overriden ops - - - - - e63c921f by Nilesh Patra at 2024-03-25T10:31:21+00:00 Change exercises.sqc post installation - do not change files in source root - - - - - 1a577145 by Nilesh Patra at 2024-03-25T16:09:07+05:30 Move from pkg-config => pkgconf - - - - - 04766961 by Nilesh Patra at 2024-03-25T16:10:02+05:30 Upload to unstable - - - - - 5 changed files: - debian/changelog - debian/control - + debian/patches/fixup-implicit-function-declaration.patch - debian/patches/series - debian/rules Changes: = debian/changelog = @@ -1,3 +1,16 @@ +hmmer2 (2.3.2+dfsg-9) unstable; urgency=medium + + * Team Upload. + * Add patch to fix FTBFS due to implicit-function-decl + * Pass GNU Test macro to resolve implicit function + warning with pthread. (Closes: #1066436) + * Also run dh_clean in addition to overridden ops + * Change exercises.sqc post installation - do not + change files in source root (Closes: #1046065, #1049476) + * Move from pkg-config => pkgconf + + -- Nilesh Patra Mon, 25 Mar 2024 16:09:47 +0530 + hmmer2 (2.3.2+dfsg-8) unstable; urgency=medium * Provide configure.ac as source for configure = debian/control = @@ -7,7 +7,7 @@ Priority: optional Build-Depends: debhelper-compat (= 13), libperl4-corelibs-perl, libsquid-dev, - pkg-config, + pkgconf, dh-exec, rename Standards-Version: 4.6.1 = debian/patches/fixup-implicit-function-declaration.patch = @@ -0,0 +1,12 @@ +--- a/src/funcs.h b/src/funcs.h +@@ -171,6 +171,9 @@ + /* mathsupport.c + * Much of this code deals with Dirichlet prior mathematics. + */ ++ ++extern double Gammln(double x); ++extern double IncompleteGamma(double a, double x); + extern int Prob2Score(float p, float null); + extern float Score2Prob(int sc, float null); + extern float Scorify(int sc); = debian/patches/series = @@ -4,3 +4,4 @@ spelling.patch use_debian_packaged_biosquid.patch build_libhmmer.a_with-fPIC.patch add-runstatedir-option.patch +fixup-implicit-function-declaration.patch = debian/rules = @@ -15,8 +15,9 @@ export AUTOHEADER = 'true' dh $@ override_dh_clean: + dh_clean if [ -e configure_not_used ] ; then mv configure_not_used configure; fi - rm -f configure.ac + rm -f configure.ac src/config.h # Trying to address #1025739 but the resulting configure file does not work override_dh_autoreconf: @@ -27,7 +28,7 @@ override_dh_autoreconf: dh_autoreconf override_dh_auto_configure: - dh_auto_configure -- --enable-threads --enable-lfs # --enable-pvm + dh_auto_configure -- --enable-threads --enable-lfs PTHREAD_CFLAGS="-D_XOPEN_SOURCE=500" # --enable-pvm # avoid duplicated definition of PACKAGE_NAME (basically conflicting with biosquid when used together) sed -i -e '/^#define PACKAGE_NAME /i #ifndef PACKAGE_NAME' \ -e '/^#define PACKAGE_NAME /a #endif' \ @@ -68,9 +69,9 @@ endif override_dh_installexamples: dh_installexamples mkdir -p $(sampledir); - sed -i "s#hmm#hmm2#g" testsuite/exercises.sqc cp -a testsuite/* $(sampledir)/; mkdir $(sampledir)/tutorial; cp -a tutorial/* $(sampledir)/tutorial; + sed -i "s#hmm#hmm2#g" $(sampledir)/exercises.sqc sed -i "s#../tut#./tut#g" $(sampledir)/exercises.sqc find $(sampledir) -name 'Makefile' | xargs sed -i "s^$(CURDIR)^.^g" View it on GitLab: https://salsa.debian.org/med-team/hmmer2/-/compare/fd3eb0a0d832a592bb9521d51a3da9b1f9dd6f19...04766961c8a832c97312b22a09f0dd61bc098504 -- View it on GitLab: https://salsa.debian.org/med-team/hmmer2/-/compare/fd3eb0a0d832a592bb9521d51a3da9b1f9dd6f19...04766961c8a832c97312b22a09f0dd61bc098504 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/hmmer2] Pushed new tag debian/2.3.2+dfsg-9
Nilesh Patra pushed new tag debian/2.3.2+dfsg-9 at Debian Med / hmmer2 -- View it on GitLab: https://salsa.debian.org/med-team/hmmer2/-/tree/debian/2.3.2+dfsg-9 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/lagan][master] 2 commits: Add patch to fix FTBFS with implicit-function-declaration (Closes: #1066580)
Nilesh Patra pushed to branch master at Debian Med / lagan Commits: 8d2e6942 by Nilesh Patra at 2024-03-25T12:32:22+05:30 Add patch to fix FTBFS with implicit-function-declaration (Closes: #1066580) - - - - - 72adfc24 by Nilesh Patra at 2024-03-25T12:32:47+05:30 Upload to unstable - - - - - 3 changed files: - debian/changelog - + debian/patches/fixup-implicit-function-declaration.patch - debian/patches/series Changes: = debian/changelog = @@ -1,3 +1,11 @@ +lagan (2.0-10) unstable; urgency=medium + + * Team Upload. + * Add patch to fix FTBFS with +implicit-function-declaration (Closes: #1066580) + + -- Nilesh Patra Mon, 25 Mar 2024 12:32:30 +0530 + lagan (2.0-9) unstable; urgency=medium * Team upload. = debian/patches/fixup-implicit-function-declaration.patch = @@ -0,0 +1,63 @@ +--- a/src/utils/cstat.c b/src/utils/cstat.c +@@ -3,6 +3,7 @@ + #include + #include + #include ++#include + + #define MAX_SEQ 31 + #define MAX(a,b) ((a)>(b)?(a):(b)) +--- a/src/order.c b/src/order.c +@@ -49,6 +49,8 @@ + + int substmatrix[256][256]; + ++int printXMFAAlign(char*, char*, align*, char*, char*); ++int printMFAAlign(char*, char*, align*, char*, char*); + + seq* readfile(FILE* input, int seqnum) { + char* res = (char*) malloc(sizeof(char)*2); +--- a/src/utils/scorecontigs.c b/src/utils/scorecontigs.c +@@ -3,6 +3,7 @@ + #include + #include + #include ++#include + + #define MAX_SEQ 1024 + #define MAX(a,b) ((a)>(b)?(a):(b)) +--- a/src/utils/overlay.c b/src/utils/overlay.c +@@ -2,6 +2,7 @@ + #include + #include + #include ++#include + + #define MAX_SEQS 63 + #define MIN2(y,z)((y)<(z))?(y):(z) +--- a/src/mlagan.c b/src/mlagan.c +@@ -31,6 +31,8 @@ + static align *simaligns[MAX_SEQ]; + static char* lagan_dir; + ++extern int printXMFAAlign(FILE*, align*); ++ + static int hptrcomp (const void *p1, const void *p2) { + int i = ((hptr*)p1)->number; + int j = ((hptr*)p2)->number; +--- a/src/prolagan.c b/src/prolagan.c +@@ -34,6 +34,8 @@ + static align *profile1 = 0; + static align *profile2 = 0; + ++extern int printXMFAAlign(FILE*, align*); ++ + static int hptrcomp (const void *p1, const void *p2) { + int i = ((hptr*)p1)->number; + int j = ((hptr*)p2)->number; = debian/patches/series = @@ -8,3 +8,4 @@ cross.patch gcc9.patch gcc10.patch gcc-lto.patch +fixup-implicit-function-declaration.patch View it on GitLab: https://salsa.debian.org/med-team/lagan/-/compare/aa800534e626e42bca17b51428def2e4e02dbd7b...72adfc24e992dca8c1e836a2ccb442ec41c06aaa -- View it on GitLab: https://salsa.debian.org/med-team/lagan/-/compare/aa800534e626e42bca17b51428def2e4e02dbd7b...72adfc24e992dca8c1e836a2ccb442ec41c06aaa You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/lagan] Pushed new tag debian/2.0-10
Nilesh Patra pushed new tag debian/2.0-10 at Debian Med / lagan -- View it on GitLab: https://salsa.debian.org/med-team/lagan/-/tree/debian/2.0-10 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/lucy] Pushed new tag debian/1.20-4
Nilesh Patra pushed new tag debian/1.20-4 at Debian Med / lucy -- View it on GitLab: https://salsa.debian.org/med-team/lucy/-/tree/debian/1.20-4 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/lucy][master] 3 commits: Add patch to fix FTBFS with implicit-function-declaration (Closes: #1066324)
Nilesh Patra pushed to branch master at Debian Med / lucy Commits: 5726e6aa by Nilesh Patra at 2024-03-24T22:14:21+05:30 Add patch to fix FTBFS with implicit-function-declaration (Closes: #1066324) - - - - - f9aba04e by Nilesh Patra at 2024-03-24T22:18:14+05:30 Add patch to remove .PU macro rather than trying to hack it in d/rules (Closes: #1047296) - - - - - f7058330 by Nilesh Patra at 2024-03-24T22:18:59+05:30 Upload to unstable - - - - - 5 changed files: - debian/changelog - + debian/patches/declare-function-prototypes-in-header.patch - + debian/patches/fixup-manpage.patch - debian/patches/series - debian/rules Changes: = debian/changelog = @@ -1,3 +1,14 @@ +lucy (1.20-4) unstable; urgency=medium + + * Team Upload. + * Remove myself from Uploaders. + * Add patch to fix FTBFS with +implicit-function-declaration (Closes: #1066324) + * Add patch to remove .PU macro rather than trying +to hack it in d/rules (Closes: #1047296) + + -- Nilesh Patra Sun, 24 Mar 2024 22:18:20 +0530 + lucy (1.20-3) unstable; urgency=medium * Remove redundant files = debian/patches/declare-function-prototypes-in-header.patch = @@ -0,0 +1,83 @@ +--- a/abi.c b/abi.c +@@ -5,6 +5,7 @@ + * + / + ++#include "utils.h" + #define VERYBAD 16 + + static struct stack_struct { +--- a/lucy.c b/lucy.c +@@ -10,6 +10,7 @@ + #include + #include + #include ++#include "utils.h" + + #define TABLE_LENGTH 1023 + #define BUFFER_LENGTH 4096 +--- a/poly.c b/poly.c +@@ -5,6 +5,7 @@ + * + / + ++#include "utils.h" + #define A 0 + #define T 3 + +--- a/qual_trim.c b/qual_trim.c +@@ -50,6 +50,7 @@ + #include + #include + #include ++#include "utils.h" + + /* the highest quality value for which we have computed the */ + /* corresponding probability of error */ +--- a/splice.c b/splice.c +@@ -5,6 +5,7 @@ + * + / + ++#include "utils.h" + #define MAXIMUM_THREADS 32 + + #define NIL 0 +--- /dev/null b/utils.h +@@ -0,0 +1,20 @@ ++#ifndef UTILS_H ++#define UTILS_H ++ ++#include ++void giveup(char *msg); ++int abi_code(int); ++void abi_align(char*, int, char*, int, int*, int*); ++void prepare_abi_mask(); ++void splice_align_left(int, char*, int, char*, int, int, int, int*); ++void splice_align_right(int, char*, int, char*, int, int, int, int*); ++void set_bracket(int, double); ++void default_windows(void); ++void quality_trim(int *, int, int, int*, int*); ++void construct_vector_tags(char*, int); ++int match_vector_tags(char*, int); ++void destroy_vector_tags(); ++int poly_at_right(char*, int); ++int poly_at_left(char*, int); ++ ++#endif +--- a/vector.c b/vector.c +@@ -6,6 +6,7 @@ + / + #include + #include ++#include "utils.h" + + extern void giveup(char *); + = debian/patches/fixup-manpage.patch = @@ -0,0 +1,7 @@ +--- a/lucy.1 b/lucy.1 +@@ -1,4 +1,3 @@ +-.PU + .TH LUCY 1 10/28/2000 "TIGR software" "Sequence Assembly Utilities" + .SH NAME + .B lucy = debian/patches/series = @@ -1,2 +1,4 @@ helpingMakefile.patch spellings.patch +declare-function-prototypes-in-header.patch +fixup-manpage.patch = debian/rules = @@ -7,7 +7,3 @@ export DEB_LDFLAGS_MAINT_APPEND = -Wl,--as-needed %: dh $@ - -override_dh_installman: - sed 1d -i lucy.1 - dh_installman View it on GitLab: https://salsa.debian.org/med-team/lucy/-/compare/5a1de8b59df3ff869a08458c32815aa1623fa267...f705833078f506e052b0dba9caf91f5a8539d0e9 -- View it on GitLab: https://salsa.debian.org/med-team/lucy/-/compare/5a1de8b59df3ff869a08458c32815aa1623fa267...f705833078f506e052b0dba9caf91f5a8539d0e9 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/lamassemble][master] [ci skip] Drop myself from uploaders field. Will not take care of its maintenance
Nilesh Patra pushed to branch master at Debian Med / lamassemble Commits: fc7ff0b0 by Nilesh Patra at 2024-02-27T20:30:05+05:30 [ci skip] Drop myself from uploaders field. Will not take care of its maintenance - - - - - 1 changed file: - debian/control Changes: = debian/control = @@ -2,9 +2,7 @@ Source: lamassemble Section: science Priority: optional Maintainer: Debian Med Packaging Team -Uploaders: - Nilesh Patra , - Étienne Mollier , +Uploaders: Étienne Mollier Build-Depends: debhelper-compat (= 13), dh-sequence-python3, View it on GitLab: https://salsa.debian.org/med-team/lamassemble/-/commit/fc7ff0b0acea0161d78facb9acf9cc2086c5a7ae -- View it on GitLab: https://salsa.debian.org/med-team/lamassemble/-/commit/fc7ff0b0acea0161d78facb9acf9cc2086c5a7ae You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/python-biom-format][master] 2 commits: Pull upstream patch to fix FTBFS (Closes: #1044074)
Nilesh Patra pushed to branch master at Debian Med / python-biom-format Commits: c11f2d26 by Nilesh Patra at 2024-02-05T00:46:28+05:30 Pull upstream patch to fix FTBFS (Closes: #1044074) - - - - - cdecfc8e by Nilesh Patra at 2024-02-05T00:46:46+05:30 Upload to unstable - - - - - 3 changed files: - debian/changelog - + debian/patches/adjust-pd-df-interaction-with-greater-than.patch - debian/patches/series Changes: = debian/changelog = @@ -1,3 +1,10 @@ +python-biom-format (2.1.15.2-3) unstable; urgency=medium + + * Team Upload. + * Pull upstream patch to fix FTBFS (Closes: #1044074) + + -- Nilesh Patra Mon, 05 Feb 2024 00:46:33 +0530 + python-biom-format (2.1.15.2-2) unstable; urgency=medium * Drop python3-future from Build-Depends = debian/patches/adjust-pd-df-interaction-with-greater-than.patch = @@ -0,0 +1,45 @@ +From 5d1c921ca2cde5d7332508503ce990a7209d1fdc Mon Sep 17 00:00:00 2001 +From: Daniel McDonald +Date: Tue, 7 Nov 2023 16:36:07 -0800 +Subject: [PATCH] MAINT: adjust to change in pd.DataFrame interaction with > + (#940) + +* MAINT: adjust to change in pd.DataFrame interaction with > + +* STY: adjust for flake8 +--- + biom/tests/test_table.py | 2 +- + biom/util.py | 4 ++-- + 2 files changed, 3 insertions(+), 3 deletions(-) + +diff --git a/biom/tests/test_table.py b/biom/tests/test_table.py +index 28d187e5..75675847 100644 +--- a/biom/tests/test_table.py b/biom/tests/test_table.py +@@ -1593,7 +1593,7 @@ def test_to_dataframe_is_sparse(self): + df = example_table.to_dataframe() + density = (float(example_table.matrix_data.getnnz()) / +np.prod(example_table.shape)) +-df_density = (df > 0).sum().sum() / np.prod(df.shape) ++df_density = (df.values > 0).sum().sum() / np.prod(df.shape) + assert np.allclose(df_density, density) + + def test_to_dataframe_dense(self): +diff --git a/biom/util.py b/biom/util.py +index 879779dc..12700839 100644 +--- a/biom/util.py b/biom/util.py +@@ -441,11 +441,11 @@ def biom_open(fp, permission='r'): + opener = h5py.File + + if mode in ['U', 'r', 'rb'] and is_gzip(fp): +-def opener(fp, mode): ++def opener(fp, mode): # noqa + return codecs.getreader('utf-8')(gzip_open(fp, mode)) + mode = 'rb' if permission in ['U', 'r'] else permission + elif mode in ['w', 'wb'] and str(fp).endswith('.gz'): +-def opener(fp, mode): ++def opener(fp, mode): # noqa + codecs.getwriter('utf-8')(gzip_open(fp, mode)) + + f = opener(fp, mode) = debian/patches/series = @@ -3,3 +3,4 @@ no-web-adds.patch fix_future_import.patch sphinx_1.6.patch posix_shell.patch +adjust-pd-df-interaction-with-greater-than.patch View it on GitLab: https://salsa.debian.org/med-team/python-biom-format/-/compare/7de41b27960ac73ede32397f30f5e897ef2c12e0...cdecfc8e4f0ddec9e28ddcd28a17a62cb7e9a933 -- View it on GitLab: https://salsa.debian.org/med-team/python-biom-format/-/compare/7de41b27960ac73ede32397f30f5e897ef2c12e0...cdecfc8e4f0ddec9e28ddcd28a17a62cb7e9a933 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/python-biom-format] Pushed new tag debian/2.1.15.2-3
Nilesh Patra pushed new tag debian/2.1.15.2-3 at Debian Med / python-biom-format -- View it on GitLab: https://salsa.debian.org/med-team/python-biom-format/-/tree/debian/2.1.15.2-3 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/python-nanoget][master] 2 commits: Versioned depends on pandas
Nilesh Patra pushed to branch master at Debian Med / python-nanoget Commits: d35ecc8a by Nilesh Patra at 2024-02-04T17:30:50+05:30 Versioned depends on pandas - - - - - c244775d by Nilesh Patra at 2024-02-04T12:05:33+00:00 Upload to unstable - - - - - 2 changed files: - debian/changelog - debian/control Changes: = debian/changelog = @@ -1,10 +1,18 @@ -python-nanoget (1.19.3-1) UNRELEASED; urgency=medium +python-nanoget (1.19.3-1) unstable; urgency=medium - * New upstream version + [ Andreas Tille ] + * Team Upload. + * New upstream version (Closes: #1044056) * Standards-Version: 4.6.2 (routine-update) * Build-Depends: s/dh-python/dh-sequence-python3/ (routine-update) - -- Andreas Tille Wed, 15 Nov 2023 11:25:46 +0100 + [ Nilesh Patra ] + * Update missing source from nanotest repo + * Add missing-sources copyright + * gunzip mixed test suite file + * Versioned depends on pandas + + -- Nilesh Patra Sun, 04 Feb 2024 12:05:21 + python-nanoget (1.16.1-2) unstable; urgency=medium = debian/control = @@ -24,7 +24,8 @@ Depends: ${python3:Depends}, ${misc:Depends}, python3-biopython, python3-pysam, - python3-nanomath + python3-nanomath, + python3-pandas (>= 2.0.0) Description: extract information from Oxford Nanopore sequencing data and alignments The Python3 module nanoget provides functions to extract useful metrics from Oxford Nanopore sequencing reads and alignments. View it on GitLab: https://salsa.debian.org/med-team/python-nanoget/-/compare/08fb8a6215e332f63e1d2401b431b00782a6b154...c244775df69050978972acb05bd99eb6eadc3b78 -- View it on GitLab: https://salsa.debian.org/med-team/python-nanoget/-/compare/08fb8a6215e332f63e1d2401b431b00782a6b154...c244775df69050978972acb05bd99eb6eadc3b78 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/python-nanoget] Pushed new tag debian/1.19.3-1
Nilesh Patra pushed new tag debian/1.19.3-1 at Debian Med / python-nanoget -- View it on GitLab: https://salsa.debian.org/med-team/python-nanoget/-/tree/debian/1.19.3-1 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/python-nanoget][master] 3 commits: Update missing source from nanotest repo
Nilesh Patra pushed to branch master at Debian Med / python-nanoget Commits: 57f4fbb1 by Nilesh Patra at 2024-02-04T16:38:14+05:30 Update missing source from nanotest repo - - - - - 986f76e7 by Nilesh Patra at 2024-02-04T16:38:14+05:30 Add missing-sources copyright - - - - - 08fb8a62 by Nilesh Patra at 2024-02-04T17:22:59+05:30 gunzip mixed test suite file - - - - - 3 changed files: - debian/copyright - + debian/missing-source/nanotest/reads-mixed-timestamp.fastq - debian/tests/run-unit-test Changes: = debian/copyright = @@ -13,6 +13,11 @@ Copyright: 2020 Andreas Tille 2022 Étienne Mollier License: GPL-3+ +Files: debian/missing-source/* +Copyright: 2016-2020 Wouter De Coster +License: GPL-3+ +Comment: Taken from https://github.com/wdecoster/nanotest + License: GPL-3+ This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by = debian/missing-source/nanotest/reads-mixed-timestamp.fastq = @@ -0,0 +1,8 @@ +@b5b5833b-9341-4886-9ffd-7dd7f876c009 runid=9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 read=33 ch=5 start_time=2023-09-12T22:36:47+00:00 +AGAAGGAGGAGGAGGAGGGAGGAGGAGGGAGGAGAAGGAGGGAGAGGAGGAGGAGGAGAGGAGGGAGGGAGGAGGAGGGAGGAGGAGGAGGGAGGAGGAGGGAGGGAGGGAGGAGGAGGGAGGGAGGGAGGGAGGAGGAGGAGGAGGGAGGAGGGAGGAGGAGGAGGAGGAGGGAGGAGGAGGGAGGAGGGAGGAGGAGGAGGAGGAGG ++ +%#&$#-(.-(.*&-)%*(+&./'/.(0++$+/&5/0+)$*+-1%).%/2/)/../.%)+%-/%+,&,.$)-*/.%+*)0--&,52&)0%)/&.0)'.-$(*%.3'/-+%-/)-+$,),&0,0%'.*%.-%'-%+-)$-+*$).-',-)%*+%*.%+-$*,%+,,(--$*)*./-%*)%..&*,%)0&.12(0,%,*$*)*$*2'*/-&/.&/.%*,%++%**%)' +@76a5b578-7c92-458b-9981-437f48b82455 runid=9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 read=26 ch=438 start_time=2023-09-13T14:17:12.357928+02:00 +ACGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCAATCGTGAAACGCTTTCGCGTTCGTGCGCCGCTTCGTACGCCAGTGCCGCTACTGGTCACGCGTTTCTGAAGCGCGTAAGCGTTACAACAATGTTTGTAGCCATCATCGGCATATCGCCATGCTAATTGAAAGCCGGTCCGGGTTCCGGCGACAACGTTCAGATGATGCTGGTGGCCTACCGGCGATAATACGAACGCTTTAATCGCTGCAATCTTGTGGATTCAGATACACGCGATCAGGCGGTCCAAGGTCTGAATACCATCGATGACACTTTCGTCATTCACTTTGCATCAGAAATGAAGCGATCATGACCCGCGACTTGCGGTATCACCCACATTCAAAGTAGGTAGCACTTGGTTTCATTCGCCATGTATTCAGATCGATTTCTGAGTTTACCCACGCGGAATGCGCTAACGGCGCAAGTCGTGCGACAATCGTCTCTTCTTTGGGTAGTCAGTCGCGGCCATCGGCATCTTCGCGTGCGATTTCGGCGTCCACGGCAGGTTGCGAGCAGCCGTGCGCAGGCGAGACATGTTGACCGCCGGCTACGGTAGCAAACCGGTACGCCGCGACGCCATGAACGATTGTGTTGTTGTAAACCACAGAACTTCTTCTTCACCCGCGAACCACGAGAGAAGGTGTGCCTGTAAATGCCGAGGCACGGGATGATCGACCTGTGGTCCAGTTCGTAAGTTTACGACGGGAGAGGACAGATTTGTTCGATGACGGAAGGGCTTCTTAATCATGACGCGGTCTTCATTCTGGTAAACGACCGAAGTCGCTCTAGATCTAGTCATCTCTCAGCTTTATTTGGAGATGTGAAACGTCAAGAACTGTTAGAGAATGGCCAGACAGATTTGTCGTACCCGAGGATACCGGTTTCTAAAGTTGTCGTTCCGACATTGATACCAGCACAGCATCAAGGAAGTGCAACTTCGCCGTTAATCGGTAGCGAATACGTCATCTTCGGTGTAGCCCAGAACGCCCATTTCGCCAGCTGGCAGCAGCAGCGGCAGCTTGTTCCTTCGTAATTTGCGGCCCAGCGGTCAGGTCAACTACGAACCGTTCTCCGGAACGCGGAACGCCATACCAGTCGGTTGCCATTCAGTTCTGGCAGTACCTAATAGCAGCACCGGTAGAGGACGGGATGATGAGGCTTACCGCGACCGCGCGCCAGTCTTTGTAGACGGGCCATCAACGTTTCTGATAGCGATGAGTAGCGTGAACGGTGGTCATCAGACCTTCGATGATGCCAGAAGTTATCGTTGATAACTTTAGCCAGCGGTGCTGGTGGTGCAGGAAGCGTTGACCGATAATACTGACCATGTTGTCAACGCTGGTATCGGGCGTTGTCTTACTGAACGGACCAGTGCTTAACCACTTTCTTCGCACCAGCGGTGATGTGTTTACGAGCAGTTTCAGCCGGTGGGAACAGACCGGTTGCTTCGGCGACAACGTCAACACCGTTCCCATTTCAGGTTAGCCGGATGCGTTCAGCGGTAACACGCAGTTACCGTTAACGATCAGATGATAAATGCCGCTTCAACGACCGTCGAAACGGCCGTGGTAGGTCATAACTTCAGCCGTAAATCGGCGTCTAACAGGTCGTTGATTTGCAACGATCTCGATGTCAGGGCGTTTCGAGCAGCGAGCTAATGCGACCGACCGGTCCGTTGTTACCTACGATAGTCAACACTGTTCCTGTATATTTGATGAATGTTTGCCTGTTTACACCTTACGCAGCGTCGCGGAATCGTGTTCAATCGTGCGACAAATCAATCCTGTGCTAAGCATTACGCATTATTTCTCTCTTTCCTTGGGCTGGCAGACCATGGTCAAAAAAAAGAGGCCCGATATGTATTGACATCGATTTAGGTGCAGCATTTCGTCGGATCAGTTTACAGGACGCCAGTTGGTGTTATGTTTGTTAAGTGTGGTCACGTAATGGCGACACGATTAAAGTGAGATGTGAACATGGCTAATAAACCTTCGACGAAGAACTGAATTGTCGAGATGCAGGTGACGCAGTGGGACAGAGCCGCCATTTACGGGTGTTACTGCATAACAAGCGTGACGGCGTCTCACTGGTTGCGATCTGCACTGTTTCATTCCCAAACCAGAAATGTGATTCCGGCTGTGGCTGGCCCGGATTTCTACGAACCATTGAAGTGAAGAATCATTCGTTATAAAGACTTATCTCACATGGAATACGCGCATAGAAATTCGTTGCGGTAACTGTGATGCCATCTGGAACTATCTTGACAGACCCGCAGCCAACGGGCAGTATTTAACTGCCTGCTTTACGCTTTACACCGACTGGCAACGAAGAAATCAGCGGTTGACGATTCAGCAACTTATTCCACAGGGCAGGATTATGGTCTTGATGCGGCATTATCAACAGCATGATGCCCGTATACCAGCGTTTGACCTGCCGTTGAACTAAATGGCTGATGGCGTTGCGTTACGACGGAACAAGAACTGCCTGCAACTGGTGATGCGCCAGCAGGCTGCCACTATATCGAAGCATATGACAGTGACACAATGGTCAGATGATGTGAAGAGCAAACAGCAGTTAAGAGGGCACAATCTCGGCAGCCTATTGCCATGTTTAAGTAGGTTCTTCCCTGCCTCAAGCTATGAAATAATGACCCACGACTCATCTCAATTATCTCGCGGCTAGTCCCAAGTCGATCTTGCGTCCCGTTCGCCCTGACGACTTCCTGAACGAAGTCTCGAACCTATTGGCCGGCAATCCCTCTCGAATTTGCTCGCGCCCTTCCGTCAACCATAACAGACCCAGCCATTCTGCGTAATTGTGATGATCTGAGTTGTAAAGC
[med-svn] [Git][med-team/emperor][master] 2 commits: Add patch to fix FTBFS with pandas 2.0 (Closes: #1050144)
Nilesh Patra pushed to branch master at Debian Med / emperor Commits: 276f8ee0 by Nilesh Patra at 2024-02-04T16:18:26+05:30 Add patch to fix FTBFS with pandas 2.0 (Closes: #1050144) - - - - - eac70e95 by Nilesh Patra at 2024-02-04T16:18:43+05:30 Upload to unstable - - - - - 3 changed files: - debian/changelog - + debian/patches/pandas-2.patch - debian/patches/series Changes: = debian/changelog = @@ -1,3 +1,10 @@ +emperor (1.0.3+ds-9) unstable; urgency=medium + + * Team Upload. + * Add patch to fix FTBFS with pandas 2.0 (Closes: #1050144) + + -- Nilesh Patra Sun, 04 Feb 2024 16:18:31 +0530 + emperor (1.0.3+ds-8) unstable; urgency=medium * Team upload. = debian/patches/pandas-2.patch = @@ -0,0 +1,80 @@ +Description: Replace pd.util.testing with pd.testing as the former has been pruned in pandas2.x +Author: Nilesh Patra +Last-Update: 2024-02-04 +--- a/tests/test_core.py b/tests/test_core.py +@@ -202,7 +202,7 @@ + feature_mf['Second'] = ['No', 'Yes', 'Noes', 'N', 'Yep'] + + # it is redundant, but the mapping file should remain untouched +-pd.util.testing.assert_frame_equal(feature_mf, emp.feature_mf, ++pd.testing.assert_frame_equal(feature_mf, emp.feature_mf, +check_names=False) + + self.assertEqual(emp.base_url, 'https://cdn.rawgit.com/biocore/emperor' +@@ -223,7 +223,7 @@ +'f.PC.481', 'f.PC.354']) + empty_mf['all'] = 'All elements' + +-pd.util.testing.assert_frame_equal(empty_mf, emp.feature_mf, ++pd.testing.assert_frame_equal(empty_mf, emp.feature_mf, +check_names=False) + + self.assertEqual(emp.base_url, 'https://cdn.rawgit.com/biocore/emperor' +@@ -291,7 +291,7 @@ + + expected.loc['PC.634'] = ['This element has no metadata'] * 3 + +-pd.util.testing.assert_frame_equal(expected.sort_index(), ++pd.testing.assert_frame_equal(expected.sort_index(), +emp.mf.sort_index(), +check_names=False) + +@@ -313,7 +313,7 @@ + + expected.loc['f.PC.636'] = ['This element has no metadata'] * 2 + +-pd.util.testing.assert_frame_equal(expected.sort_index(), ++pd.testing.assert_frame_equal(expected.sort_index(), +emp.feature_mf.sort_index(), +check_names=False) + +--- a/tests/test_pandas.py b/tests/test_pandas.py +@@ -66,9 +66,9 @@ + self.assertTrue(isinstance(emp, Emperor)) + self.assertEqual(emp.dimensions, 4) + +-pd.util.testing.assert_frame_equal(self.df, emp.mf) ++pd.testing.assert_frame_equal(self.df, emp.mf) + +-pd.util.testing.assert_frame_equal(emp.ordination.samples, ++pd.testing.assert_frame_equal(emp.ordination.samples, +self.samples) + + def test_scatterplot_reordered(self): +@@ -80,11 +80,11 @@ + self.assertEqual(emp.base_url, 'https://cdn.rawgit.com/biocore/' + 'emperor/new-api/emperor/support_files') + +-pd.util.testing.assert_frame_equal(self.df, emp.mf) ++pd.testing.assert_frame_equal(self.df, emp.mf) + + reordered = self.samples[['num_3', 'num_2', 'num_1', 'num_4']].copy() + +-pd.util.testing.assert_frame_equal(emp.ordination.samples, ++pd.testing.assert_frame_equal(emp.ordination.samples, +reordered) + + def test_bad_column_names(self): +--- a/tests/test_util.py b/tests/test_util.py +@@ -282,7 +282,7 @@ + mf = pd.DataFrame(data=MAPPING_FILE_DATA, columns=columns) + obs = validate_and_process_custom_axes(mf, ['DOB']) + exp = pd.DataFrame(data=MAPPING_FILE_DATA_CONVERTED, columns=columns) +-pd.util.testing.assert_frame_equal(obs, exp) ++pd.testing.assert_frame_equal(obs, exp) + + def test_custom_axes_non_existent_names(self): + columns = ['SampleID', 'BarcodeSequence', 'LinkerPrimerSequence', = debian/patches/series = @@ -5,3 +5,4 @@ EditSectionTitle.patch 8b803cd81586b832550eaa2428fa2d0dd581d35f.patch no_future_dependency.patch python3.12,patch +pandas-2.patch View it on GitLab: https://salsa.debian.org/med-team/emperor/-/compare/4a4c3aa4cad762974555feb99dd979a77519332b...eac70e95bb2b95d8b897acfef1c3468cf940bb15 -- View it on GitLab: https://salsa.debian.org/med-team/emperor/-/compare/4a4c3aa4cad762974555feb99dd979a77519332b...eac70e95bb2b95d8b897acfef1c3468cf940bb15 You're receiving this email because o
[med-svn] [Git][med-team/emperor] Pushed new tag debian/1.0.3+ds-9
Nilesh Patra pushed new tag debian/1.0.3+ds-9 at Debian Med / emperor -- View it on GitLab: https://salsa.debian.org/med-team/emperor/-/tree/debian/1.0.3+ds-9 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/mirtop] Pushed new tag debian/0.4.25-5
Nilesh Patra pushed new tag debian/0.4.25-5 at Debian Med / mirtop -- View it on GitLab: https://salsa.debian.org/med-team/mirtop/-/tree/debian/0.4.25-5 You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/mirtop][master] 4 commits: Revert "Enable experimental in salsa-ci.yml"
Nilesh Patra pushed to branch master at Debian Med / mirtop Commits: f05fad48 by Nilesh Patra at 2024-02-04T14:45:11+05:30 Revert "Enable experimental in salsa-ci.yml" This reverts commit 22554ec4496d11bbae115ef77c74608eed025690. - - - - - a16870eb by Nilesh Patra at 2024-02-04T14:45:19+05:30 Revert "Force pandas >= 2.0 to make sure the version from experimental will be taken" This reverts commit 3eac0bc2e1bc3140be8321341e7d70c24ea417b3. - - - - - 74187802 by Nilesh Patra at 2024-02-04T09:53:12+00:00 Add patch to fix FTBFS with pandas 2.0 (Closes: #1044055) - - - - - 81d0909c by Nilesh Patra at 2024-02-04T09:53:12+00:00 Upload to unstable - - - - - 5 changed files: - debian/changelog - debian/control - + debian/patches/pandas-2.patch - debian/patches/series - debian/salsa-ci.yml Changes: = debian/changelog = @@ -1,9 +1,9 @@ -mirtop (0.4.25-5) UNRELEASED; urgency=medium +mirtop (0.4.25-5) unstable; urgency=medium - * Team upload. - * Enable experimental in salsa-ci.yml + * Team Upload. + * Add patch to fix FTBFS with pandas 2.0 (Closes: #1044055) - -- Andreas Tille Mon, 29 Jan 2024 09:05:28 +0100 + -- Nilesh Patra Sun, 04 Feb 2024 14:47:21 +0530 mirtop (0.4.25-4) unstable; urgency=medium = debian/control = @@ -13,7 +13,7 @@ Build-Depends: debhelper-compat (= 13), python3-recommonmark, python3-pysam, python3-pybedtools, - python3-pandas (>= 2.0), + python3-pandas, python3-biopython Standards-Version: 4.6.2 Vcs-Browser: https://salsa.debian.org/med-team/mirtop @@ -29,7 +29,7 @@ Depends: ${python3:Depends}, ${sphinxdoc:Depends}, python3-pysam, python3-pybedtools, - python3-pandas (>= 2.0), + python3-pandas, python3-biopython Description: annotate miRNAs with a standard mirna/isomir naming (Python 3) The main goal of this project is to create a reflection group on metazoan = debian/patches/pandas-2.patch = @@ -0,0 +1,23 @@ +Description: Replace append with concat as per pandas changed API +Author: Nilesh Patra +Last-Update: 2024-02-04 +--- a/mirtop/gff/stats.py b/mirtop/gff/stats.py +@@ -107,13 +107,13 @@ + # ref_miRNA_mean + category = "ref_miRNA_mean" + if sum(df['category']==category) == 0: +-df2 = {'category': category, 'sample': df['sample'].iat[0], 'counts': 0} +-df = df.append(df2, ignore_index = True) ++df2 = pd.DataFrame({'category': category, 'sample': df['sample'].iat[0], 'counts': 0}, index=[0]) ++df = pd.concat([df, df2], ignore_index = True) + + category = "isomiR_sum" + if sum(df['category']==category) == 0: +-df2 = {'category': category, 'sample': df['sample'].iat[0], 'counts': 0} +-df = df.append(df2, ignore_index = True) ++df2 = pd.DataFrame({'category': category, 'sample': df['sample'].iat[0], 'counts': 0}, index=[0]) ++df = pd.concat([df, df2], ignore_index = True) + + return df + = debian/patches/series = @@ -2,3 +2,4 @@ spelling fix-circular-import.patch pytest.patch python3-syntax.patch +pandas-2.patch = debian/salsa-ci.yml = @@ -2,7 +2,3 @@ include: - https://salsa.debian.org/salsa-ci-team/pipeline/raw/master/salsa-ci.yml - https://salsa.debian.org/salsa-ci-team/pipeline/raw/master/pipeline-jobs.yml - -variables: - # Build against pandas 2.x in experimental to recreate the test failure reported in bug #1044055 - RELEASE: 'experimental' View it on GitLab: https://salsa.debian.org/med-team/mirtop/-/compare/3eac0bc2e1bc3140be8321341e7d70c24ea417b3...81d0909c3d41653740aac0d1b9627fad9740216f -- View it on GitLab: https://salsa.debian.org/med-team/mirtop/-/compare/3eac0bc2e1bc3140be8321341e7d70c24ea417b3...81d0909c3d41653740aac0d1b9627fad9740216f You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/pydicom][pristine-tar] Deleted 1 commit: pristine-tar data for pydicom_2.4.4.orig.tar.gz
Nilesh Patra pushed to branch pristine-tar at Debian Med / pydicom WARNING: The push did not contain any new commits, but force pushed to delete the commits and changes below. Deleted commits: 840bc84f by Andreas Tille at 2024-01-26T10:47:09+01:00 pristine-tar data for pydicom_2.4.4.orig.tar.gz - - - - - 2 changed files: - + pydicom_2.4.4.orig.tar.gz.delta - + pydicom_2.4.4.orig.tar.gz.id Changes: = pydicom_2.4.4.orig.tar.gz.delta = Binary files /dev/null and b/pydicom_2.4.4.orig.tar.gz.delta differ = pydicom_2.4.4.orig.tar.gz.id = @@ -0,0 +1 @@ +2c856cce92c647e4157bd0abb45dd5983a4ef509 View it on GitLab: https://salsa.debian.org/med-team/pydicom/-/commit/840bc84fb5866dd279f0f665b2d2bd2ebbbf125c -- View it on GitLab: https://salsa.debian.org/med-team/pydicom/-/commit/840bc84fb5866dd279f0f665b2d2bd2ebbbf125c You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/pydicom][master] 5 commits: Do not hack around sphinx. This is an issue w/ sphinx-gallery which has been fixed in latest upload
Nilesh Patra pushed to branch master at Debian Med / pydicom Commits: 055717d2 by Nilesh Patra at 2024-01-26T15:56:02+05:30 Do not hack around sphinx. This is an issue w/ sphinx-gallery which has been fixed in latest upload - - - - - 9ad448bd by Nilesh Patra at 2024-01-26T16:25:16+05:30 Properly copy tests dir during build - - - - - 51ccaaf8 by Nilesh Patra at 2024-01-26T17:22:51+05:30 Run tests after install step - - - - - 3030db7d by Nilesh Patra at 2024-01-26T17:38:43+05:30 d/clean: Cleanup generated docs - - - - - 590d8dfe by Nilesh Patra at 2024-01-26T17:38:51+05:30 Upload to unstable - - - - - 4 changed files: - debian/changelog - + debian/clean - debian/control - debian/rules Changes: = debian/changelog = @@ -1,5 +1,6 @@ -pydicom (2.4.3-1) UNRELEASED; urgency=medium +pydicom (2.4.3-1) unstable; urgency=medium + [ Andreas Tille ] * Team upload. * New upstream version * Drop transitional package python3-dicom @@ -11,7 +12,14 @@ pydicom (2.4.3-1) UNRELEASED; urgency=medium python3-mpl-sphinx-theme, python3-scipy * Hack around strange error of sphinx by simply ignoring it - -- Andreas Tille Wed, 16 Aug 2023 10:34:49 +0200 + [ Nilesh Patra ] + * Add versioned Builddep against sphinx-gallery to fixup sphinx 7.2 issues +Closes: #1042612 + * Properly copy tests dir during build + * Run tests after install step + * d/clean: Cleanup generated docs + + -- Nilesh Patra Fri, 26 Jan 2024 17:38:13 +0530 pydicom (2.3.1-1) unstable; urgency=medium = debian/clean = @@ -0,0 +1,5 @@ +doc/build/ +doc/generated/ +doc/auto_examples/ +doc/reference/generated/ +pydicom.egg-info/ = debian/control = @@ -15,7 +15,7 @@ Build-Depends: debhelper-compat (= 13), python3-docutils, python3-pil, python3-sphinx, - python3-sphinx-gallery, + python3-sphinx-gallery (>= 0.10.1-4~), python3-sphinx-rtd-theme, python3-sphinx-issues, python3-sphinx-copybutton, = debian/rules = @@ -8,16 +8,26 @@ PYS = $(shell pyversions -r) export http_proxy=http://127.0.0.1:9/ export https_proxy=http://127.0.0.1:9/ +# Copy the test package, as it is inside the root package (pydicom/tests). +export PYBUILD_BEFORE_TEST=cp -r {dir}/pydicom/tests {build_dir}/pydicom +# Cleanup the test package after dh_auto_test has run +export PYBUILD_AFTER_TEST=rm -r {build_dir}/pydicom/tests + %: dh $@ --buildsystem=pybuild --with python3,sphinxdoc override_dh_auto_build: dh_auto_build - cd doc; PYTHONPATH=.. python3 /usr/bin/sphinx-build -N -bhtml . build/html || true # FIXME: This ends in some error, but the doc seems OK so far + cd doc; PYTHONPATH=.. python3 /usr/bin/sphinx-build -N -bhtml . build/html + +override_dh_auto_test: override_dh_auto_install: -find -name __pycache__ | xargs rm -r dh_auto_install +ifeq (,$(filter nocheck,$(DEB_BUILD_OPTIONS))) + dh_auto_test +endif override_dh_clean: dh_clean View it on GitLab: https://salsa.debian.org/med-team/pydicom/-/compare/397bb810563ff0d604522d5411c57e5b69adb517...590d8dfe91cd0c26d957689d2d154402f01b8ffd -- View it on GitLab: https://salsa.debian.org/med-team/pydicom/-/compare/397bb810563ff0d604522d5411c57e5b69adb517...590d8dfe91cd0c26d957689d2d154402f01b8ffd You're receiving this email because of your account on salsa.debian.org. ___ debian-med-commit mailing list debian-med-com...@alioth-lists.debian.net https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
[med-svn] [Git][med-team/pydicom][upstream] Deleted 1 commit: New upstream version 2.4.4
Nilesh Patra pushed to branch upstream at Debian Med / pydicom WARNING: The push did not contain any new commits, but force pushed to delete the commits and changes below. Deleted commits: d249a95a by Andreas Tille at 2024-01-26T10:47:03+01:00 New upstream version 2.4.4 - - - - - 5 changed files: - doc/Makefile - + doc/fix_search.py - doc/make.bat - pydicom/_version.py - pyproject.toml Changes: = doc/Makefile = @@ -59,6 +59,7 @@ html: rm -rf $(BUILDDIR)/html/_images #rm -rf _build/doctrees/ $(SPHINXBUILD) -b html $(ALLSPHINXOPTS) $(BUILDDIR)/html + python3 fix_search.py # TODO remove when sphinx_rtd_theme fixes upstream touch $(BUILDDIR)/html/.nojekyll @echo @echo "Build finished. The HTML pages are in $(BUILDDIR)/html." = doc/fix_search.py = @@ -0,0 +1,22 @@ +""" +A temporary fix for https://github.com/pydicom/pydicom/issues/1965 +while waiting for upstream sphinx_rtd_theme to fix/remove their +dependency on jQuery. +""" +from pathlib import Path +import re + + +search_html = Path("./_build/html/search.html") +assert search_html.exists() + +with open(search_html) as fp: +html = fp.read() + +pat = r"(\s+jQuery.+searchindex\.js.+\s+<\/script>)" +repl = r'